Ctla2a (NM_001145799) Mouse Untagged Clone

CAT#: MC207255

Ctla2a (untagged) - Mouse cytotoxic T lymphocyte-associated protein 2 alpha (Ctla2a), transcript variant 2, (10ug)


  "NM_001145799" in other vectors (3)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Ctla2a"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ctla2a
Synonyms Ctla-2a
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207255 representing NM_001145799
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATGTCAGCTGCTCCACCCCCTGATCCAAGTTTGGATAATGAGTGGAAAGAATGGAAGACGAAATTTG
CAAAAGCCTACAATCTGAATGAAGAAAGACACAGAAGACTCGTGTGGGAGGAGAATAAGAAGAAAATTGA
GGCACACAATGCAGACTATGAGCAGGGCAAGACCAGCTTCTACATGGGCCTGAATCAATTTAGTGACTTG
ACTCCAGAAGAATTCAAGACAAATTGCTATGGAAACTCACTGAATAGAGGAGAAATGGCTCCTGATTTGC
CTGAATATGAAGATTTGGGAAAGAACAGCTATCTGACACCTGGAAGGGCTCAGCCAGAGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001145799
ORF Size 342 bp
Insert Size 342
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001145799.1, NP_001139271.1
RefSeq Size 1335
RefSeq ORF 342
Locus ID 13024
Gene Summary Not known, expressed in activated T-cell. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR and uses an downstream translational start codon, compared to variant 1. The resulting isoform (b) is shorter at the N-terminus, compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.