Phlda2 (NM_009434) Mouse Untagged Clone

CAT#: MC207432

Phlda2 (untagged) - Mouse pleckstrin homology-like domain, family A, member 2 (Phlda2), (10ug)


  "NM_009434" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Phlda2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Phlda2
Synonyms Ipl; Tssc3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207432 representing NM_009434
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTTCGAAAATCGTGATGTCTTCGAAAACCGTGAAGACCTCCGACGAGATCCTTTGCGAGGGCGAGC
TGGAGAAGCGAAGCGACAGCCTGTTCCAGGTATGGAAGAAGAAGCGCTGCGTGCTCACCGCCGACCGCCT
GCGCCTCTTCTCCGGGAAAACCAGCCCCGCCAAGGAGCTGTTTTTCCACTCCATCCTCAAGGTGGACTGC
GTGGAGCACACCTCTAAGTACGTGTACTTCACCATCGTCACCAACTATTACAAGGAGATCGACTTCCGCT
GCACGGTGGAGAGCTGCTGGAACGCGGCCATCACCATGGCGCTGATCGACTTCCAGAACCGTCGGGCGCT
GCAAGACTTTCCCCGCTACCGGTATCAGCGCTCTGAGTCTGAAATGCCTTCCGAGCCGGGAGAGCAGAGC
GCTCTGGGTCCGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_009434
ORF Size 435 bp
Insert Size 435
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_009434.2, NP_033460.1
RefSeq Size 737
RefSeq ORF 435
Locus ID 22113
Gene Summary This gene is one of several genes in the imprinted gene domain on chromosome 7. Studies using knockout mice have shown that the product of this gene regulates placental growth. Transcripts from this gene are most abundant in placenta and yolk sac, and are almost entirely transcribed from the maternal allele. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.