Anapc11 (NM_025389) Mouse Untagged Clone

CAT#: MC207566

Anapc11 (untagged) - Mouse anaphase promoting complex subunit 11 (Anapc11), transcript variant 2, (10ug)


  "NM_025389" in other vectors (3)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Anapc11"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Anapc11
Synonyms 1110011I19Rik; R75218
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207566 representing NM_025389
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGGTGAAAATTAAATGTTGGAATGGTGTGGCCACTTGGCTCTGGGTAGCCAATGATGAGAACTGCG
GCATCTGCAGGATGGCGTTTAATGGCTGCTGTCCAGACTGTAAGGTGCCTGGTGATGACTGCCCCCTCGT
GTGGGGACAGTGCTCCCACTGCTTCCACATGCACTGCATCCTCAAGTGGCTGAATGCGCAGCAGGTGCAG
CAGCACTGCCCCATGTGTCGCCAGGAGTGGAAGTTCAAAGAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_025389
ORF Size 255 bp
Insert Size 255
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_025389.4, NP_079665.1
RefSeq Size 3229
RefSeq ORF 255
Locus ID 66156

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.