Capzb (NM_009798) Mouse Untagged Clone

CAT#: MC207998

Capzb (untagged) - Mouse capping protein (actin filament) muscle Z-line, beta (Capzb), transcript variant 2, (10ug)


  "NM_009798" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Capzb"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Capzb
Synonyms 1700120C01Rik; AI325129; Cappb1; CPB1; CPB2; CPbeat2; CPbeta1; CPbeta2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207998 representing NM_009798
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGCGATCAGCAGCTGGACTGCGCCTTGGACCTGATGAGGCGCCTGCCTCCACAGCAGATTGAGAAGA
ACCTCAGCGATCTGATCGACCTGGTCCCCAGTCTGTGTGAAGATCTCCTGTCATCTGTTGACCAGCCCCT
GAAAATTGCCAGAGACAAGGTGGTGGGCAAGGATTACCTTTTGTGTGACTACAACAGAGACGGGGACTCC
TATAGGTCACCGTGGAGTAACAAGTATGACCCTCCTTTGGAAGATGGGGCCATGCCATCTGCTCGGCTCA
GAAAGCTGGAGGTAGAGGCCAACAATGCCTTCGACCAATACCGAGACCTGTATTTTGAAGGTGGGGTCTC
ATCAGTCTACCTCTGGGATCTTGATCATGGCTTTGCTGGAGTGATCCTCATAAAGAAAGCTGGAGATGGA
TCCAAGAAGATCAAAGGCTGCTGGGATTCCATCCACGTGGTGGAAGTGCAGGAGAAGTCCAGCGGCCGTA
CTGCCCATTACAAGTTGACCTCCACGGTGATGCTATGGCTGCAAACCAACAAATCCGGCTCGGGCACCAT
GAACCTGGGAGGCAGCCTAACCAGACAGATGGAGAAAGACGAAACTGTGAGTGACTGTTCCCCACACATA
GCCAACATCGGGCGCCTGGTGGAGGACATGGAAAACAAAATCCGAAGCACGCTGAATGAGATCTACTTTG
GAAAAACAAAGGACATCGTCAACGGGCTGAGGTCTGTGCAGACGTTTGCAGACAAATCAAAGCAAGAAGC
GCTTAAGAACGACCTGGTGGAGGCCTTGAAGAGAAAGCAGCAGTGTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_009798
ORF Size 819 bp
Insert Size 819
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_009798.4, NP_033928.1
RefSeq Size 1676
RefSeq ORF 819
Locus ID 12345
Gene Summary This gene encodes the beta subunit of a highly conserved filamentous actin capping protein that binds the barbed end of filamentous actin to stabilize it and terminate elongation. Interaction of this protein with the barbed end of the actin filament occurs through binding of the amphipathic helix at the C-terminus to the hydrophobic cleft on the actin molecule. This gene is required for a variety of dynamic actin-mediated processes including organization of lamellipodia and filopodia, growth cone morphology and neurite outgrowth in hippocampal neurons, and asymmetric spindle migration and polar body extrusion during oocyte maturation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Transcript Variant: This variant (2) lacks an alternate exon in the 3' coding region, which results in translation extending to a distinct 3' coding region compared to variant 1. The encoded isoform (b) is shorter than and has a distinct C-terminus compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.