Aga (NM_001005847) Mouse Untagged Clone

CAT#: MC208116

Aga (untagged) - Mouse aspartylglucosaminidase (Aga), transcript variant 1, (10ug)


  "NM_001005847" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Aga
Synonyms AW060726
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208116 representing NM_001005847
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGCGGAAGTCGAATCTGTCTCTGCTTCTCCTACTGCTGGTCCTGGGCATGCCCCTGGTGCGGGGCT
CCAGCCCTCTGCCCCTGGTCGTCAACACTTGGCCTTTTAAGAATGCCACTGAAGCAGCGTGGTGGACATT
GCTATCTGGAGGTTCTGCCCTGGATGCAGTGGAGAACGGCTGTGCTGTGTGTGAGAAGGAGCAGTGTGAT
GGGACTGTAGGCTTTGGAGGAAGTCCTGATGAAGGTGGCGAAACCACCCTGGATGCCATGATAATGGATG
GCACTGCCATGGATGTGGGAGCAGTGGGAGGCCTTAGAAGAATTAAAAACGCGATTGGCGTGGCGCGGAG
AGTCCTGGAGCATACCACACACACGCTTTTAGTGGGGGACTCAGCCACCAAGTTTGCTGAAAGTATGGGG
TTTACTAATGAGGACTTGTCTACCAAAACCTCAAGAGATCTTCATTCAGATTGGCTTTCTCGAAATTGCC
AGCCAAATTATTGGAGAAATGTTATTCCAGATCCCTCAAAATACTGTGGACCCTACAAACCATCTGGTTT
CTTAAAGCAGAGTATTTCTCCCCACAAAGAAGAAGTGGATATCCACAGCCATGATACTATTGGCATGGTT
GTAATCCATAAGACGGGACATACTGCTGCTGGCACATCCACAAATGGTATAAAATTCAAAATACCTGGTC
GTGTAGGGGATTCACCAATCCCTGGAGCCGGAGCCTATGCTGATGACACGGCTGGAGCAGCTGCAGCCAC
TGGCGATGGTGACACACTCCTGCGCTTTCTGCCGAGCTACCAAGCTGTAGAATATATGAGAGGAGGAGAT
GACCCAGCCATAGCTTGCCAAAAAGTGATTTTAAGAATTCAGAAATACTATCCAAACTTCTTTGGAGCGG
TCATATGTGCCAGTGTGAACGGAAGTTATGGTGCTGCTTGCAACAAACTTCCAACATTTACACAATTTAG
TTTCATGGTTTCTAATTCTTTACACAATGAGCCAACCGAAAAAAAAGTAGACTGCATCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001005847
Insert Size 1041 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001005847.2, NP_001005847.1
RefSeq Size 1307 bp
RefSeq ORF 1041 bp
Locus ID 11593
Cytogenetics 8 B1.3
Gene Summary This gene encodes an amidase enzyme that participates in the breakdown of glycoproteins in the cell. The encoded protein undergoes proteolytic processing to generate a mature enzyme. Mice lacking the encoded protein exhibit accumulation of aspartylglucosamine along with lysosomal vacuolization, axonal swelling in the gracile nucleus and impaired neuromotor coordination. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Oct 2015]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.