Btg3 (NM_009770) Mouse Untagged Clone

CAT#: MC208204

Btg3 (untagged) - Mouse B-cell translocation gene 3 (Btg3), (10ug)


  "NM_009770" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Btg3"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Btg3
Synonyms ANA; tob5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208204 representing NM_009770
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGAACGAAATTGCGGCTGTTGTCTTCTTTTTCACAAGGCTAGTTCGAAAGCATGACAAGTTGAAAA
AAGAAGCAGTTGAGAGGTTTGCTGAGAAATTAACTCAAATACTTCAAGAGAAATATAAAAATCACTGGTA
TCCAGAAAAACCATCCAAAGGTCAGGCCTACAGATGCATTCGTGTCAATAAGTTTCAGAGAGTTGATCCC
GATGTCCTGAAAGCCTGTGAGAACAGCTGCATCTTGTACAGCGACCTGGGCTTGCCTAAGGAGCTTACAC
TCTGGGTGGATCCGTGTGAGGTGTGCTGCCGGTATGGAGAGAAAAACAATGCGTTCATTGTTGCCAGCTT
TGAAAATGAGGACGAGAACAAGGATGAAATCTCCAAGAAAGTTAGCAGGGCTCTGGATAAGGTGACCTCT
GATTATCACTCAGGGTCCTCTTCCTCAGATGAAGACACAAGCAAGGAAGTGGACGTGAAACCCAGCTCAG
TGGCGGCAACACCAAGCCCCGTGTACCAGATTTCAGAACTGATATTCCCACCTCTTCCAATGTGGCACCC
TTTGCCCAGAAAAAAGCCAGGAATGTATCGAGGGAGCGGCCATCAGACTCACTACCCTCCTCCTGTTCCA
TTTGCTTATCCAAATCCAGGAAGGAAGAATAAACCATTCCGCCCAATTCCAGTGACATGGGTACCTCCTC
CTGGAATGCATTGTGACCGAAATCACTGGATTAATCCTCACATGTTAGCACCTCACTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_009770
ORF Size 759 bp
Insert Size 759
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_009770.3, NP_033900.1
RefSeq Size 1414
RefSeq ORF 759
Locus ID 12228
Gene Summary This gene encodes B cell translocation gene 3, a member of the BTG gene family. This family is defined by a conserved N-terminal domain, known to bind transcription factors, and a less conserved C-terminal domain. This protein is thought to have anti-proliferative properties, and may be involved in regulating the G1-S transition to suppress cell cycle progression. Mice deficient for this gene display an increased incidence of lung cancers, and many human lung cancer cells exhibit decreased levels of B cell translocation gene 3. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 17. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.