Capzb (NM_001037761) Mouse Untagged Clone

CAT#: MC208213

Capzb (untagged) - Mouse capping protein (actin filament) muscle Z-line, beta (Capzb), transcript variant 1, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Capzb
• Synonyms: 1700120C01Rik; AI325129; Cappb1; CPB1; CPB2; CPbeat2; CPbeta1; CPbeta2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208213 representing NM_001037761
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAGCGATCAGCAGCTGGACTGCGCCTTGGACCTGATGAGGCGCCTGCCTCCACAGCAGATTGAGAAGA
  ACCTCAGCGATCTGATCGACCTGGTCCCCAGTCTGTGTGAAGATCTCCTGTCATCTGTTGACCAGCCCCT
  GAAAATTGCCAGAGACAAGGTGGTGGGCAAGGATTACCTTTTGTGTGACTACAACAGAGACGGGGACTCC
  TATAGGTCACCGTGGAGTAACAAGTATGACCCTCCTTTGGAAGATGGGGCCATGCCATCTGCTCGGCTCA
  GAAAGCTGGAGGTAGAGGCCAACAATGCCTTCGACCAATACCGAGACCTGTATTTTGAAGGTGGGGTCTC
  ATCAGTCTACCTCTGGGATCTTGATCATGGCTTTGCTGGAGTGATCCTCATAAAGAAAGCTGGAGATGGA
  TCCAAGAAGATCAAAGGCTGCTGGGATTCCATCCACGTGGTGGAAGTGCAGGAGAAGTCCAGCGGCCGTA
  CTGCCCATTACAAGTTGACCTCCACGGTGATGCTATGGCTGCAAACCAACAAATCCGGCTCGGGCACCAT
  GAACCTGGGAGGCAGCCTAACCAGACAGATGGAGAAAGACGAAACTGTGAGTGACTGTTCCCCACACATA
  GCCAACATCGGGCGCCTGGTGGAGGACATGGAAAACAAAATCCGAAGCACGCTGAATGAGATCTACTTTG
  GAAAAACAAAGGACATCGTCAACGGGCTGAGATCTCTTGATGCTATCCCCGACAACCACAAGTTTAAGCA
  GTTGCAGAGGGAACTTTCTCAAGTGCTGACCCAGCGCCAGGTCTACATCCAGCCTGATAATTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001037761
• Insert Size: 834 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001037761.2, NP_001032850.1
• RefSeq Size: 1789 bp
• RefSeq ORF: 834 bp
• Locus ID: 12345
• Cytogenetics: 4 70.59 cM
• Gene Summary: This gene encodes the beta subunit of a highly conserved filamentous actin capping protein that binds the barbed end of filamentous actin to stabilize it and terminate elongation. Interaction of this protein with the barbed end of the actin filament occurs through binding of the amphipathic helix at the C-terminus to the hydrophobic cleft on the actin molecule. This gene is required for a variety of dynamic actin-mediated processes including organization of lamellipodia and filopodia, growth cone morphology and neurite outgrowth in hippocampal neurons, and asymmetric spindle migration and polar body extrusion during oocyte maturation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
  Transcript Variant: This variant (1) represents the longest transcript and encodes isoform a.