Cd72 (NM_007654) Mouse Untagged Clone
CAT#: MC208255
Cd72 (untagged) - Mouse CD72 antigen (Cd72), transcript variant 2, (10ug)
"NM_007654" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Cd72 |
Synonyms | CD72c; Ly-19; Ly-32; Ly-m19; Lyb-2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208255 representing NM_007654
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_007654 |
ORF Size | 1065 bp |
Insert Size | 1065 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_007654.2, NP_031680.2 |
RefSeq Size | 1482 |
RefSeq ORF | 1065 |
Locus ID | 12517 |
Gene Summary | Plays a role in B-cell proliferation and differentiation. [UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1, resulting in a shorter protein (isoform 2). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR219399 | Cd72 (Myc-DDK-tagged) - Mouse CD72 antigen (Cd72), transcript variant 2 |
USD 350.00 |
|
MG219399 | Cd72 (GFP-tagged) - Mouse CD72 antigen (Cd72) transcript variant 2, (10ug) |
USD 390.00 |
|
MR219399L3 | Lenti ORF clone of Cd72 (Myc-DDK-tagged) - Mouse CD72 antigen (Cd72), transcript variant 2 |
USD 550.00 |
|
MR219399L4 | Lenti ORF clone of Cd72 (mGFP-tagged) - Mouse CD72 antigen (Cd72), transcript variant 2 |
USD 550.00 |
{0} Product Review(s)
Be the first one to submit a review