Cnih2 (NM_009920) Mouse Untagged Clone

CAT#: MC208304

Cnih2 (untagged) - Mouse cornichon homolog 2 (Drosophila) (Cnih2), (10ug)


  "NM_009920" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Cnih2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cnih2
Synonyms CNIH-2; Cnil
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208304 representing NM_009920
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGTTCACCTTCGCAGCATTCTGCTACATGCTCACCCTGGTGCTGTGCGCCTCCCTCATCTTCTTTG
TCATCTGGCACATCATAGCCTTTGATGAGCTGCGGACTGACTTCAAGAACCCCATCGACCAGGGGAACCC
AGCGCGGGCACGCGAGCGTTTGAAAAACATCGAACGCATCTGCTGCCTCCTGAGGAAGCTGGTGGTCCCG
GAATATTCCATCCACGGCCTCTTCTGTCTGATGTTTCTGTGTGCAGCAGAGTGGGTGACCCTGGGCCTCA
ACATCCCCCTCCTCTTCTACCACCTCTGGAGGTACTTCCACCGTCCTGCGGATGGCTCTGAGGTCATGTA
TGATGCGGTCTCTATCATGAATGCTGACATCCTCAACTACTGCCAGAAGGAGTCCTGGTGCAAACTCGCC
TTCTACCTGCTGTCCTTCTTCTATTACCTGTACAGTATGGTTTATACGTTGGTGAGCTTCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_009920
ORF Size 483 bp
Insert Size 483
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_009920.4, NP_034050.1
RefSeq Size 1361
RefSeq ORF 483
Locus ID 12794
Gene Summary This gene encodes a protein that is an auxiliary subunit of the ionotropic glutamate receptor of the AMPA subtype. This protein is similar to a Drosophila protein involved in anterior-posterior and dorsal-ventral patterning. Cnih2 conditional knockout mice exhibit reduced AMPA receptor synaptic transmission in the hippocampus. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
Transcript Variant: This variant (1) represents the shorter transcript and encodes the longer isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.