Cox8a (NM_007750) Mouse Untagged Clone

CAT#: MC208311

Cox8a (untagged) - Mouse cytochrome c oxidase, subunit VIIIa (Cox8a), (10ug)


  "NM_007750" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Cox8a"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cox8a
Synonyms COX8L
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208311 representing NM_007750
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTGTCCTGACGCCACTGCTGCTGAGGAGCCTGACCGGCTCGGCCCGGCGGCTCATGGTGCCGCGGG
CTCAGGTCCACTCGAAGCCGGCGCGGGAGCAGCTCGGGGTCCTGGATATCACCATTGGGCTCACTTCCTG
CTTCGTGTGTTGTCTTCTGCCTGCGGGCTGGGTCCTGTCACACCTGGAGAGCTACAAGAAGCGGGAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_007750
ORF Size 210 bp
Insert Size 210
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_007750.2, NP_031776.1
RefSeq Size 545
RefSeq ORF 210
Locus ID 12868
Gene Summary This protein is one of the nuclear-coded polypeptide chains of cytochrome c oxidase, the terminal oxidase in mitochondrial electron transport. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.