Crem (NM_001110854) Mouse Untagged Clone

CAT#: MC208323

Crem (untagged) - Mouse cAMP responsive element modulator (Crem), transcript variant 10, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Crem
• Synonyms: ICER; ICERI
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208323 representing NM_001110854
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCAAAAGCCCAACATGGCTGTAACTGGAGATGAAACTGATGAGGAGACTGACCTTGCCCCAAGTCACA
  TGGCTGCTGCCACAGGTGACATGCCAACTTACCAGATCCGAGCTCCTACTACTGCTTTGCCACAAGGTGT
  GGTGATGGCTGCCTCACCAGGAAGCCTGCACAGTCCCCAGCAACTAGCAGAAGAAGCAACTCGCAAGCGG
  GAGCTGAGGCTGATGAAAAACAGGGAAGCTGCCCGGGAGTGTCGCAGGAAGAAGAAAGAATATGTCAAAT
  GTCTTGAAAATCGTGTGGCTGTGCTTGAAAATCAAAACAAGACCCTCATTGAGGAACTCAAGGCCCTCAA
  AGACCTTTATTGCCATAAAGCAGAGTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001110854
• ORF Size: 378 bp
• Insert Size: 378
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001110854.1, NP_001104324.2
• RefSeq Size: 2046
• RefSeq ORF: 378
• Locus ID: 12916
• Gene Summary: This gene encodes a basic-leucine zipper domain-containing protein that localizes to gene promoters, where it binds to the cyclic AMP response element (CRE). Different protein isoforms encoded by this gene may function as either activators or repressors of transcription. Activity of this gene is important in multiple developmental processes, including spermatogenesis. Mutation of this gene causes male infertility. Alternative splicing and promoter usage result in multiple transcript variants for this gene. [provided by RefSeq, Oct 2012]
  Transcript Variant: This variant (10) contains multiple differences in the UTRs and coding region, including lacking multiple exons, compared to variant 1. It represents use of an alternate promoter and contains an alternate 5' coding region. The encoded isoform (10) is shorter and has distinct N- and C- termini, compared to isoform 1.