Crem (NM_001110850) Mouse Untagged Clone

CAT#: MC208330

Crem (untagged) - Mouse cAMP responsive element modulator (Crem), transcript variant 4, (10ug)


  "NM_001110850" in other vectors (4)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "Crem"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Crem
Synonyms ICER; ICERI
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208330 representing NM_001110850
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGCAAATGTGGCAGGAAAAAGTATATGAGGACAAATGTAAGGCAAATGACCATGGAAACAGTTGAAT
CACAGCAGGATCGAAGTGTAACACGTTCTGTGGCAGAGCATAGCTCTGCTCATATGCAGACTGGTCAAAT
TTCTGTTCCTACTCTAGCTCAGGTAGCAACAATTGCAGAGACAGATGATTCTGCAGACTCAGAAGTAATT
GATTCGCATAAACGTAGAGAAATTCTTTCACGAAGACCCTCATATAGAAAAATACTGAATGAACTTTCCT
CTGATGTGCCTGGTATTCCCAAGATTGAAGAAGAAAAATCAGAGGAAGAAGGGACACCACCTAACATTGC
TACCATGGCAGTACCAACTAGCATATATCAGACTAGCACGGGGCAATACACTGCCACAGGTGACATGCCA
ACTTACCAGATCCGAGCTCCTACTACTGCTTTGCCACAAGGTGTGGTGATGGCTGCCTCACCAGGAAGCC
TGCACAGTCCCCAGCAACTAGCAGAAGAAGCAACTCGCAAGCGGGAGCTGAGGCTGATGAAAAACAGGGA
AGCTGCCCGGGAGTGTCGCAGGAAGAAGAAAGAATATGTCAAATGTCTTGAAAATCGTGTGGCTGTGCTT
GAAAATCAAAACAAGACCCTCATTGAGGAACTCAAGGCCCTCAAAGACCTTTATTGCCATAAAGCAGAGT
AA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001110850
ORF Size 702 bp
Insert Size 702
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001110850.2, NP_001104320.1
RefSeq Size 2404
RefSeq ORF 702
Locus ID 12916
Gene Summary This gene encodes a basic-leucine zipper domain-containing protein that localizes to gene promoters, where it binds to the cyclic AMP response element (CRE). Different protein isoforms encoded by this gene may function as either activators or repressors of transcription. Activity of this gene is important in multiple developmental processes, including spermatogenesis. Mutation of this gene causes male infertility. Alternative splicing and promoter usage result in multiple transcript variants for this gene. [provided by RefSeq, Oct 2012]
Transcript Variant: This variant (4, also known as alpha gamma) lacks three alternate in-frame exons and uses an alternate splice site in the 3' coding region, compared to variant 1. The encoded isoform (4) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.