Dclk1 (NM_001111053) Mouse Untagged Clone

CAT#: MC208366

Dclk1 (untagged) - Mouse doublecortin-like kinase 1 (Dclk1), transcript variant 4, (10ug)


  "NM_001111053" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Dclk1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Dclk1
Synonyms 1700113D08Rik; 2810480F11Rik; AI836758; Click-I; Cpg16; Dcamkl1; Dcl; Dclk; mKIAA0369
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208366 representing NM_001111053
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCGTTCGGCAGAGATATGGAGTTGGAGCATTTTGATGAGCGGGACAAGGCGCAGAGGTACAGCAGGG
GGTCCCGTGTGAATGGCCTGCCCAGCCCCACACACAGCGCCCACTGCAGCTTCTACCGCACCCGCACCCT
GCAGACACTCAGCTCCGAGAAGAAAGCCAAGAAGGTTCGATTCTACAGAAATGGTGACCGCTACTTCAAA
GGAATTGTGTATGCCATCTCCCCAGACCGCTTCAGATCTTTCGAGGCCCTGCTGGCTGATTTGACCCGAA
CTCTCTCGGATAATGTGAATTTGCCCCAGGGGGTGAGAACCATCTACACCATCGATGGACTCAAGAAGAT
CTCCAGCCTGGACCAGCTGGTGGAAGGTGAAAGCTATGTCTGCGGCTCCATCGAGCCCTTTAAGAAGCTG
GAGTACACCAAGAATGTGAACCCCAACTGGTCAGTGAACGTCAAGACCACCTCAGCCTCCCGCGCAGTGT
CTTCTTTGGCCACTGCCAAGGGTGGGCCTTCGGAGGTTCGGGAGAATAAGGATTTCATTCGACCCAAGCT
GGTCACCATCATCAGAAGTGGGGTGAAGCCACGGAAGGCTGTCAGAATCCTGCTGAACAAGAAGACGGCT
CACTCCTTCGAGCAGGTTCTCACTGACATTACCGACGCTATCAAGCTGGACTCCGGTGTGGTGAAGCGCC
TGTACACTCTGGATGGGAAGCAGGTGATGTGCCTTCAGGACTTTTTTGGTGACGATGACATTTTTATTGC
ATGTGGACCAGAGAAGTTCCGTTACCAGGATGATTTCTTGCTAGATGAAAGTGAATGTCGAGTGGTGAAA
TCAACTTCTTACACCAAAATAGCATCAGCGTCCCGCAGAGGCACAACCAAGAGCCCAGGACCTTCCCGGA
GAAGCAAGTCCCCAGCCTCCACCAGCTCAGTTAATGGAACCCCTGGTAGTCAGCTCTCTACTCCACGCTC
GGGCAAGTCACCAAGTCCATCACCCACCAGCCCAGGAAGCCTGCGGAAGCAGAGGGACCTGTACCGCCCC
CTCTCGTCGGATGATTTGGACTCAGTAGGAGACTCAGTGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001111053
ORF Size 1092 bp
Insert Size 1092
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001111053.1, NP_001104523.1
RefSeq Size 6026
RefSeq ORF 1092
Locus ID 13175
Gene Summary This gene encodes a member of the protein kinase superfamily and the doublecortin family. The protein encoded by this gene contains two N-terminal doublecortin domains, which bind microtubules and regulate microtubule polymerization, a C-terminal serine/threonine protein kinase domain, which shows substantial homology to Ca2+/calmodulin-dependent protein kinase, and a serine/proline-rich domain in between the doublecortin and the protein kinase domains, which mediates multiple protein-protein interactions. The microtubule-polymerizing activity of the encoded protein is independent of its protein kinase activity. The encoded protein is involved in several different cellular processes, including neuronal migration, retrograde transport, neuronal apoptosis and neurogenesis. This gene is up-regulated by brain-derived neurotrophic factor and associated with memory and general cognitive abilities. Multiple transcript variants generated by two alternative promoter usage and alternative splicing have been found, but the biological validity of some variants has not been determined. These variants encode different isoforms, which are differentially expressed and have different kinase activities. [provided by RefSeq, Sep 2010]
Transcript Variant: This variant (4, also known as DCL (PMID: 17313568)) is produced from the 5' promoter. It lacks several 3' exons but has an alternate 3' exon, as compared to variant 5. The resulting isoform (4) has a shorter and distinct C-terminus, and lacks a serine/proline-rich domain and a protein kinase domain, as compared to isoform 5. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.