Dgcr6 (NM_010047) Mouse Untagged Clone

CAT#: MC208387

Dgcr6 (untagged) - Mouse DiGeorge syndrome critical region gene 6 (Dgcr6), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Dgcr6
• Synonyms: AU044152
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208387 representing NM_010047
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGTAGAGAGCATGGCACCAGCCAGCTCCTTTCAGCAGCGCCTGTCCTACACCACGCTCAGCGACTTGG
  CCCTGGCGCTGCTCGACGGAACGGTGTTTGAAATCGTGCAGGGTCTTCTGGAGATTCAGCACCTCACTGA
  GAAGAGCCTCTACAACCAGAGACTGCGGCTGCAGAACGAACACCGAGTGCTCAGACAGACTCTAAGGCAG
  AAGCACCTGGAAGCCCAGCAGTCCTGCCGGCCCCACAACTTGCCAGTGCTCCAGGCAGCTCAGCAGCGTG
  AGCTGGAGGCCATGGAACATCGGATCCGGGAGGAGCAGCAGGCTATGGACCGAAAGATTGTCCTGGAGCT
  GGACCGGAAGGTTGCCGACCAGCAGAGCACACTGGAGAAGGCAGGGGTAGCTGGTTTCTACGTGACCACC
  AATCCTCAGGAGCTGACGCTGCAGATGAACCTATTGGAACTCATCAGGAAGCTGCAGCAGAGGGGCTGCC
  AAGTGGGAAAGGCAGCTCTGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_010047
• ORF Size: 513 bp
• Insert Size: 513
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_010047.4, NP_034177.1
• RefSeq Size: 1552
• RefSeq ORF: 513
• Locus ID: 13353
• Gene Summary: This gene encodes a protein that is similar to the gonadal protein in Drosophila (fruit fly). The encoded protein is thought to play a role in migration of neural crest cells during development. Deletions in the human gene are associated with DiGeorge syndrome (or velocardiofacial syndrome) which has many clinical features including cardiac abnormalities, cleft palate, atypical facial features, hypocalcemia, hypoparathyroidism and defective development or congenital absence of the thymus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
  Transcript Variant: This variant (3) represents the use of an alternate promoter and has multiple differences compared to variant 1. These differences result in a different 5' UTR and cause translation initiation at an alternate start codon compared to variant 1. The encoded isoform (3) has a distinct N-terminus and is shorter than isoform 1.