Edn3 (NM_007903) Mouse Untagged Clone

CAT#: MC208421

Edn3 (untagged) - Mouse endothelin 3 (Edn3), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Edn3
• Synonyms: ET-3; ls; PPET3; tmgc48
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_007903, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGCCGGGGCTGTGGCTCCTTCTCGGGCTCACAGTGACCTCCGCTGCAGGACTTGTGCCTTGCCCCC
  AGTCTGGGGACTCTGGCAGAGCCAGTGTGTCCCAGGGTCCCCCTGAAGCTGGATCAGAGAGGGGCTGTGA
  AGAGACTGTGGCTGGCCCTGGTGAGAGGATTGTGTCCCCAACAGTTGCACTGCCTGCACAGCCTGAAAGC
  GCTGGGCAGGAACGGGCACCAGGCAGGTCTGGGAAACAAGAGGACAAGGGGCTGCCTGCACACCACCGCC
  CTCGCCGCTGCACGTGCTTCACTTACAAGGACAAGGAGTGTGTCTACTATTGCCACCTGGACATCATCTG
  GATTAACACTCCTGAACAGACTGTGCCCTATGGACTGTCCAACTACAGAGAAAGCCTTCGGGGAAAGAGG
  TCCTTGGGGCCAGTTCCAGAAAGCTCCCAGCCTTCTCCGTGGACACGCTTGCGTTGTACTTGTATGGGGG
  CGGATGACAAGGCCTGTGCACACTTCTGTGCACGCACCAGAGATGTCACCAGTTATTCCGGGAGAGCAGA
  AAGGCCAGCTGCAGAAGAGATGCGGGAGACTGGAGGCCCACGTCAAAGGTTGATGTCAAGGACAGATAAA
  GCCCACCGGCCTTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_007903
• ORF Size: 645 bp
• Insert Size: 645
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: BC137727, AAI37728
• RefSeq Size: 2412
• RefSeq ORF: 645
• Locus ID: 13616
• Gene Summary: This gene is a member of the endothelin family whose members encode proteins that act on G protein-coupled receptors. Endothelins are produced as large prepropolypeptide precursors that undergo a first cleavage by a subtilisin serine protease to form an inactive intermediate, which in turn is cleaved again by endothelin-converting enzyme 1 (ECE-1) to yield the active 21 amino acid peptide. This gene encodes a protein which is expressed in neural crest cells (NCC), binds to endothelin receptor b (Ednrb) and plays an essential role in the development of NCC-derived cell lineages including melanocytes and enteric neurons. Mutations in this gene are associated with terminal aganglionosis and white spotted coat in mice and Hirschsprung's disease and Waardenburg syndrome in humans. [provided by RefSeq, Apr 2013]