Fcer1a (NM_010184) Mouse Untagged Clone

CAT#: MC208469

Fcer1a (untagged) - Mouse Fc receptor, IgE, high affinity I, alpha polypeptide (Fcer1a), (10ug)


  "NM_010184" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Fcer1a"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Fcer1a
Synonyms Fce1a; fcepsilonri; FcERI; Fcr-5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_010184, the custom clone sequence may differ by one or more nucleotides


ATGGTCACTGGAAGGTCTGCCCAGCTGTGCCTAGCACTGCTGTTCATGTCTCTTGATGTCATTCTGACAG
CCACTGAGAAATCTGTACTGACCTTGGACCCACCATGGATTAGAATATTTACAGGAGAGAAAGTGACCCT
TTCCTGCTATGGGAACAATCACCTTCAAATGAACTCTACTACTAAATGGATCCACAATGGTACCGTCTCT
GAGGTGAACTCTTCACATTTGGTCATTGTGAGTGCCACCGTTCAAGACAGTGGAAAATACATATGTCAGA
AGCAAGGATTGTTTAAGAGTAAACCTGTGTACTTGAATGTAACGCAAGATTGGCTGCTCCTTCAGACATC
TGCTGACATGGTCTTAGTCCATGGATCCTTTGACATCAGATGCCATGGCTGGAAGAACTGGAATGTCCGC
AAGGTGATCTACTACAGGAATGACCATGCTTTCAACTACAGTTATGAGAGCCCCGTCTCCATTAGAGAGG
CCACACTGAATGACAGTGGCACCTACCACTGCAAGGGCTATCTTAGGCAGGTGAAATATGAATCTGACAA
ATTCAGAATTGCTGTAGTAAAAGCTTACAAATGCAAGTATTATTGGCTACAACTAATTTTCCCATTGTTG
GTGGCGATTCTGTTTGCTGTGGACACGGGGTTATTGCTCTCAACCGAAGAACAGTTCAAATCAGTCTTGG
AGATTCAGAAGACTGGAAAATACAAGAAAGTTGAAACCGAACTCCTAACCTAG


Restriction Sites SgfI-MluI     
ACCN NM_010184
ORF Size 753 bp
Insert Size 753
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC125455, AAI25456
RefSeq Size 869
RefSeq ORF 753
Locus ID 14125
Gene Summary Binds to the Fc region of immunoglobulins epsilon. High affinity receptor. Responsible for initiating the allergic response. Binding of allergen to receptor-bound IgE leads to cell activation and the release of mediators (such as histamine) responsible for the manifestations of allergy. The same receptor also induces the secretion of important lymphokines. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.