Fut1 (NM_008051) Mouse Untagged Clone

CAT#: MC208512

Fut1 (untagged) - Mouse fucosyltransferase 1 (Fut1), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Fut1
• Synonyms: H
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_008051, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTGGACTCCCAGCCGGAGGCAGCTCTGCCTGGCATTTCTGTTGGTCTGTGTGCTCTCTGCCGGCTCCT
  TCTTTTTCCACCTGAATGGAGGAAACTTCTTTCGAAATGGTCTAACTCTCTCTGTCCTGTGTTCAGACTA
  TCACCTGCTGAAGTCCCCAGTGGCCATGGTATGCCTACCTCATCCATTGCAGACATCTAATGGCTCCCCT
  TCCTGTCCTGAGCAGTCCTCCTCACTCTCTGGGACTTGGACAATCACCCCAGGAGGCAGGTTTGGTAACC
  AGATGGGGCAGTATGCTACATTGCTGGCCCTAGCCCAGCTCAATGGTCGCCAAGCCTTCATCCAACCTGA
  GATGCATGCCGCCCTGGCCCCCGTGTTCCGAATCTCCCTGCCAGTGCTGGACCCTGAGGTGGACAGCCTC
  ACACCTTGGCAGCACTTAGTCCTACATGACTGGATGTCAGAGGAGTACTCCCATCTGGAGGACCCATTTC
  TCAAGCTGTCTGGTTTCCCCTGCTCTTGGACCTTTTTCCATCATCTTCGGGAACAGATTCGTAGGGAATT
  CACTCTGCATAACCATCTACGGGAAGGTGCCCAGTACCTGTTGAGCGGGCTCCGTATAGGCCCGGCGGGC
  ATCCGCCCTCATACCTTTGTGGGTGTCCATGTGCGTCGTGGAGACTATCTGGAGGTGATGCCCAATCGCT
  GGAAGGGTGTGGTGGGTGACCGAGCTTACCTCCAGCAAGCCATGGACTGGTTCCGGGCCCGACACAAAGA
  CCCCATCTTTGTGGTCACCAGCAATGGCATGAAATGGTGTTTGGAGAACATTGACACATCCCATGGTGAT
  GTGGTCTTCGCTGGCAATGGACAGGAGGGTACACCGGGGAAGGACTTTGCACTTCTCACACAGTGTAACC
  ACACCATCATGACTATTGGCACCTTTGGCTTCTGGGCTGCCTACTTAGCTGGTGGAGACACGGTCTACCT
  TGCAAACTTCACCCTGCCAGATTCGGAGTTTCTGAAGATCTTCAGGCCTGAGGCTGCCTTCCTGCCTGAG
  TGGGTGGGCATCAATGCAGACTTGTCCCCGCTGCAGGCTCAATTTGACCCCTGGAAGCCAGACAGTCTTT
  TTAGATTGGTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_008051
• ORF Size: 1134 bp
• Insert Size: 1134
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: NM_008051.5, NP_032077.2
• RefSeq Size: 2578
• RefSeq ORF: 1134
• Locus ID: 14343
• Gene Summary: This gene is one of three genes in mouse which encode a galactoside 2-L-fucosyltransferase. These genes differ in their developmental- and tissue-specific expression. The encoded type II membrane protein is anchored in the Golgi apparatus and controls the final step in the creation of alpha (1,2) fucosylated carbhohydrates by the addition of a terminal fucose in an alpha (1,2) linkage. This enzyme is required for the synthesis of the Lewis antigen as well as the H-antigen, a precursor of the A and B antigens of the ABH histo-blood group. The biological function of the fucosylated carbhohydrate products is thought to involve cell-adhesion and interactions with microorganisms. Disruption of this gene impairs development of the olfactory nerve and maturation of the glomerular layer of the main olfactory bulb. Alternative splicing results in multiple transcript variants which encode distinct isoforms. [provided by RefSeq, Dec 2012]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note:This RefSeq record was created from transcript and genomic sequence data because no single transcript from the same strain was available for the full length of the gene. The extent of this transcript is supported by transcript alignments and orthologous data.