Igf1 (NM_001111274) Mouse Untagged Clone
CAT#: MC208754
Igf1 (untagged) - Mouse insulin-like growth factor 1 (Igf1), transcript variant 3, (10ug)
"NM_001111274" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Igf1 |
Synonyms | C730016P09Rik; Igf-1; Igf-I |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208754 representing NM_001111274
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGACCGCACCTGCAATAAAGATACACATCATGTCGTCTTCACACCTCTTCTACCTGGCGCTCTGCTTGC TCACCTTCACCAGCTCCACCACAGCTGGACCAGAGACCCTTTGCGGGGCTGAGCTGGTGGATGCTCTTCA GTTCGTGTGTGGACCGAGGGGCTTTTACTTCAACAAGCCCACAGGCTATGGCTCCAGCATTCGGAGGGCA CCTCAGACAGGCATTGTGGATGAGTGTTGCTTCCGGAGCTGTGATCTGAGGAGACTGGAGATGTACTGTG CCCCACTGAAGCCTACAAAAGCAGCCCGCTCTATCCGTGCCCAGCGCCACACTGACATGCCCAAGACTCA GAAGTCCCCGTCCCTATCGACAAACAAGAAAACGAAGCTGCAAAGGAGAAGGAAAGGAAGTACATTTGAA GAACACAAGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001111274 |
ORF Size | 432 bp |
Insert Size | 432 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001111274.1, NP_001104744.1 |
RefSeq Size | 7039 |
RefSeq ORF | 432 |
Locus ID | 16000 |
Gene Summary | This gene encodes a member of the insulin-like growth factor (IGF) family of proteins that promote growth and development during fetal and postnatal life. This gene is predominantly expressed in the liver and the encoded protein undergoes proteolytic processing to generate a disulfide-linked mature polypeptide. Transgenic disruption of this gene in mice results in reduced postnatal survival and severe growth retardation. Mice lacking the encoded protein exhibit generalized organ hypoplasia including underdevelopment of the central nervous system and developmental defects in bone, muscle and reproductive systems. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Sep 2015] Transcript Variant: This variant (3) differs in the 5' UTR and 5' coding region, compared to variant 1. These differences cause translation initiation from a distinct start codon and result in an isoform (3) with a novel N-terminus, compared to isoform 1. This isoform (3) is also known as IIB. This isoform (3) may undergo proteolytic processing similar to isoform 4. Sequence Note: This RefSeq was created from transcript and genomic sequence because transcript sequence consistent with the reference assembly was not available for all regions of the RefSeq transcript. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR227054 | Igf1 (Myc-DDK-tagged) - Mouse insulin-like growth factor 1 (Igf1), transcript variant 3 |
USD 200.00 |
|
MG227054 | Igf1 (GFP-tagged) - Mouse insulin-like growth factor 1 (Igf1) transcript variant 3, (10ug) |
USD 220.00 |
|
MR227054L3 | Lenti ORF clone of Igf1 (Myc-DDK-tagged) - Mouse insulin-like growth factor 1 (Igf1), transcript variant 3 |
USD 400.00 |
|
MR227054L4 | Lenti ORF clone of Igf1 (mGFP-tagged) - Mouse insulin-like growth factor 1 (Igf1), transcript variant 3 |
USD 400.00 |
{0} Product Review(s)
Be the first one to submit a review