Il17a (NM_010552) Mouse Untagged Clone

CAT#: MC208774

Il17a (untagged) - Mouse interleukin 17A (Il17a), (10ug)


  "NM_010552" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Il17a"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Il17a
Synonyms Ctla-8; Ctla8; IL-17; IL-17A; Il17
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208774 representing NM_010552
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGTCCAGGGAGAGCTTCATCTGTGTCTCTGATGCTGTTGCTGCTGCTGAGCCTGGCGGCTACAGTGA
AGGCAGCAGCGATCATCCCTCAAAGCTCAGCGTGTCCAAACACTGAGGCCAAGGACTTCCTCCAGAATGT
GAAGGTCAACCTCAAAGTCTTTAACTCCCTTGGCGCAAAAGTGAGCTCCAGAAGGCCCTCAGACTACCTC
AACCGTTCCACGTCACCCTGGACTCTCCACCGCAATGAAGACCCTGATAGATATCCCTCTGTGATCTGGG
AAGCTCAGTGCCGCCACCAGCGCTGTGTCAATGCGGAGGGAAAGCTGGACCACCACATGAATTCTGTTCT
CATCCAGCAAGAGATCCTGGTCCTGAAGAGGGAGCCTGAGAGCTGCCCCTTCACTTTCAGGGTCGAGAAG
ATGCTGGTGGGTGTGGGCTGCACCTGCGTGGCCTCGATTGTCCGCCAGGCAGCCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_010552
ORF Size 477 bp
Insert Size 477
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC119303, AAI19304
RefSeq Size 569
RefSeq ORF 477
Locus ID 16171
Gene Summary This gene encodes a pro-inflammatory cytokine that is a member of the interleukin-17 family. The encoded protein plays a central role in host defense against diverse pathogens. The encoded protein is produced by activated T-cells and certain cell types of innate immune system. The active protein functions as either a homodimer with other interleukin-17 family members and signals through the interleukin-17 receptor to induce inflammatory cytokine production. Aberrant expression of this gene is associated with autoinflammatory diseases including rheumatoid arthritis, psoriasis and multiple sclerosis. [provided by RefSeq, Sep 2015]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.