Ins2 (NM_001185083) Mouse Untagged Clone

CAT#: MC208792

Ins2 (untagged) - Mouse insulin II (Ins2), transcript variant 1, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ins2
• Synonyms: AA986540; Ins-2; InsII; Mody; Mody4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208792 representing NM_001185083
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCCCTGTGGATGCGCTTCCTGCCCCTGCTGGCCCTGCTCTTCCTCTGGGAGTCCCACCCCACCCAGG
  CTTTTGTCAAGCAGCACCTTTGTGGTTCCCACCTGGTGGAGGCTCTCTACCTGGTGTGTGGGGAGCGTGG
  CTTCTTCTACACACCCATGTCCCGCCGTGAAGTGGAGGACCCACAAGTGGCACAACTGGAGCTGGGTGGA
  GGCCCGGGAGCAGGTGACCTTCAGACCTTGGCACTGGAGGTGGCCCAGCAGAAGCGTGGCATTGTAGATC
  AGTGCTGCACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001185083
• ORF Size: 333 bp
• Insert Size: 333
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001185083.2, NP_001172012.1
• RefSeq Size: 473
• RefSeq ORF: 333
• Locus ID: 16334
• Gene Summary: This gene encodes insulin, a peptide hormone that plays a vital role in the regulation of carbohydrate and lipid metabolism. The encoded precursor protein undergoes proteolytic cleavage to produce a disulfide-linked heterodimeric functional protein that is stored in secretory granules. An increase in blood glucose levels, among others, induces the release of insulin from the secretory granules. Mice deficient in the functional hormone encoded by this gene develop diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
  Transcript Variant: This variant (1) represents the shortest transcript. Variants 1-3 encode the same protein.