Pla2g1b (NM_011107) Mouse Untagged Clone

CAT#: MC209183

Pla2g1b (untagged) - Mouse phospholipase A2, group IB, pancreas (Pla2g1b), (10ug)


  "NM_011107" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Pla2g1b"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Pla2g1b
Synonyms Pla2a; sPLA2IB
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209183 representing NM_011107
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAACTCCTTCTGCTGGCTGCTCTGCTCACAGCAGGCGCTGCTGCACACAGCATCAGCCCTCGGGCTG
TGTGGCAGTTCCGCAATATGATCAAGTGCACCATCCCCGGGAGTGATCCCCTGAAGGATTACAACAACTA
TGGCTGCTACTGTGGCTTGGGCGGCTGGGGCACCCCAGTGGACGACTTAGACAGGTGCTGCCAGACTCAT
GACCACTGCTACAGTCAGGCCAAGAAGCTGGAAAGCTGTAAATTCCTCATAGACAACCCCTACACCAACA
CTTACTCCTACTCATGCTCCGGGAGCGAGATCACCTGCAGCGCCAAAAACAACAAATGCGAGGACTTCAT
CTGCAACTGTGACCGTGAGGCCGCCATCTGCTTCTCCAAGGTCCCGTACAACAAGGAATACAAAAACCTT
GACACCGGGAAATTCTGTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_011107
ORF Size 441 bp
Insert Size 441
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_011107.1, NP_035237.1
RefSeq Size 552
RefSeq ORF 441
Locus ID 18778
Gene Summary PA2 catalyzes the calcium-dependent hydrolysis of the 2-acyl groups in 3-sn-phosphoglycerides, this releases glycerophospholipids and arachidonic acid that serve as the precursors of signal molecules. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.