Prm3 (NM_013638) Mouse Untagged Clone

CAT#: MC209233

Prm3 (untagged) - Mouse protamine 3 (Prm3), (10ug)


  "NM_013638" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Prm3"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Prm3
Synonyms BC061127; PX; Pxg
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209233 representing NM_013638
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGTTCCCGCTGTGCCAAGCTCAGCACTGGCCATGGCCCAGCCCAGAACACTGGTCACAGCCGTGGCC
ACGAGTCCTCCATGAAGAAGCTCGTGGCCTGTGTGAGTCAAGACAACTTTTCCCTGTCATCAGAGGGCGA
GGAAGAGGAGGAGGACGAGGAAGAGGAGGAGGAGGAAGAAGAAGAAGAGGAAGAGGAGCAAATCCCGGTG
AAGGGCAAGCTGCTGCTGCTGGAGCCCGAAAAGCAAGAGAGCGCCGAGGATGGGGAGGCCCAGCCAAGCC
CCGAGCCCAAGCAGACACACTCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_013638
ORF Size 306 bp
Insert Size 306
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_013638.2, NP_038666.2
RefSeq Size 407
RefSeq ORF 306
Locus ID 19120
Gene Summary Protamines substitute for histones in the chromatin of sperm during the haploid phase of spermatogenesis. They compact sperm DNA into a highly condensed, stable and inactive complex. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.