Ccl2 (NM_011333) Mouse Untagged Clone

CAT#: MC209362

Ccl2 (untagged) - Mouse chemokine (C-C motif) ligand 2 (Ccl2), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ccl2
• Synonyms: AI323594; HC11; JE; MCAF; MCP-1; MCP1; Scya2; Sigje; SMC-CF
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209362 representing NM_011333
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCAGGTCCCTGTCATGCTTCTGGGCCTGCTGTTCACAGTTGCCGGCTGGAGCATCCACGTGTTGGCTC
  AGCCAGATGCAGTTAACGCCCCACTCACCTGCTGCTACTCATTCACCAGCAAGATGATCCCAATGAGTAG
  GCTGGAGAGCTACAAGAGGATCACCAGCAGCAGGTGTCCCAAAGAAGCTGTAGTTTTTGTCACCAAGCTC
  AAGAGAGAGGTCTGTGCTGACCCCAAGAAGGAATGGGTCCAGACATACATTAAAAACCTGGATCGGAACC
  AAATGAGATCAGAACCTACAACTTTATTTAAAACTGCATCTGCCCTAAGGTCTTCAGCACCTTTGAATGT
  GAAGTTGACCCGTAAATCTGAAGCTAATGCATCCACTACCTTTTCCACAACCACCTCAAGCACTTCTGTA
  GGAGTGACCAGTGTGACAGTGAACTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_011333
• ORF Size: 447 bp
• Insert Size: 447
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: NM_011333.3, NP_035463.1
• RefSeq Size: 806
• RefSeq ORF: 447
• Locus ID: 20296
• Gene Summary: This gene is one of several cytokine genes clustered on chromosome 11. Chemokines are a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of N-terminal cysteine residues of the mature peptide. This chemokine is a member of the CC subfamily which is characterized by two adjacent cysteine residues. This cytokine displays chemotactic activity for monocytes and memory T cells but not for neutrophils. The human ortholog has been implicated in the pathogenesis of diseases characterized by monocytic infiltrates, such as psoriasis, rheumatoid arthritis, and atherosclerosis. [provided by RefSeq, Sep 2015]