Sumo3 (NM_019929) Mouse Untagged Clone
CAT#: MC209426
Sumo3 (untagged) - Mouse SMT3 suppressor of mif two 3 homolog 3 (yeast) (Sumo3), (10ug)
"NM_019929" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Sumo3 |
Synonyms | 2810014B19Rik; D10Ertd345e; SMT3A; Smt3h1; SUMO-3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209426 representing NM_019929
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCGGAAGAGAAGCCCAAGGAGGGTGTGAAGACAGAGAATGACCACATCAACCTGAAAGTGGCGGGGC AGGATGGCTCGGTGGTACAGTTCAAGATCAAGAGGCACACCCCACTGAGCAAGCTGATGAAGGCCTACTG TGAGAGGCAGGGCTTGTCAATGAGGCAGATTCGATTCCGGTTTGATGGACAACCAATCAATGAAACAGAC ACTCCAGCCCAGCTGGAGATGGAGGATGAGGACACCATTGATGTATTCCAGCAGCAGACAGGAGGATCAG CCTCCCGAGGGAGCGTCCCCACACCCAACCGTTGTCCTGACCTGTGCTATTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_019929 |
ORF Size | 333 bp |
Insert Size | 333 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Reference Data | |
RefSeq | NM_019929.4, NP_064313.1 |
RefSeq Size | 2630 |
RefSeq ORF | 333 |
Locus ID | 20610 |
Gene Summary | This gene encodes a member of the small ubiquitin-like modifier family. The encoded protein may regulate a variety of proteins in many pathways via a post-translational modification, known as SUMOylation. This activity may play a role in a wide variety of cellular processes, including nuclear transport, DNA replication and repair, mitosis, transcriptional regulation, and signal transduction. Disruption of some of these processes has been associated with cerebral ischemia, neural dysfunction, and heart disease. A pseudogene of this gene has been defined on the X chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014] Transcript Variant: This variant (1) encodes isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR225911 | Sumo3 (Myc-DDK-tagged) - Mouse SMT3 suppressor of mif two 3 homolog 3 (yeast) (Sumo3) |
USD 200.00 |
|
MG225911 | Sumo3 (GFP-tagged) - Mouse SMT3 suppressor of mif two 3 homolog 3 (yeast) (Sumo3), (10ug) |
USD 220.00 |
|
MR225911L3 | Lenti ORF clone of Sumo3 (Myc-DDK-tagged) - Mouse SMT3 suppressor of mif two 3 homolog 3 (yeast) (Sumo3) |
USD 400.00 |
|
MR225911L4 | Lenti ORF clone of Sumo3 (mGFP-tagged) - Mouse SMT3 suppressor of mif two 3 homolog 3 (yeast) (Sumo3) |
USD 400.00 |
{0} Product Review(s)
Be the first one to submit a review