Thy1 (NM_009382) Mouse Untagged Clone

CAT#: MC209528

Thy1 (untagged) - Mouse thymus cell antigen 1, theta (Thy1), (10ug)


  "NM_009382" in other vectors (6)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Thy1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Thy1
Synonyms CD90; T25; Thy-1; Thy-1.2; Thy1.1; Thy1.2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209528 representing NM_009382
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAACCCAGCCATCAGCGTCGCTCTCCTGCTCTCAGTCTTGCAGGTGTCCCGAGGGCAGAAGGTGACCA
GCCTGACAGCCTGCCTGGTGAACCAAAACCTTCGCCTGGACTGCCGCCATGAGAATAACACCAAGGATAA
CTCCATCCAGCATGAGTTCAGCCTGACCCGAGAGAAGAGGAAGCACGTGCTCTCAGGCACCCTTGGGATA
CCCGAGCACACGTACCGCTCCCGCGTCACCCTCTCCAACCAGCCCTATATCAAGGTCCTTACCCTAGCCA
ACTTCACCACCAAGGATGAGGGCGACTACTTTTGTGAGCTTCAAGTCTCGGGCGCGAATCCCATGAGCTC
CAATAAAAGTATCAGTGTGTATAGAGACAAGCTGGTCAAGTGTGGCGGCATAAGCCTGCTGGTTCAGAAC
ACATCCTGGATGCTGCTGCTGCTGCTTTCCCTCTCCCTCCTCCAAGCCCTGGACTTCATTTCTCTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_009382
ORF Size 489 bp
Insert Size 489
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Reference Data
RefSeq BC054436, AAH54436
RefSeq Size 1718
RefSeq ORF 489
Locus ID 21838
Gene Summary This gene encodes a glycoprotein that is anchored to the cell surface of thymocytes, neuronal and other cells through a glycosyl-phosphatidylinositol moiety. A soluble form of the encoded protein has also been detected in serum and cerebrospinal fluid. The encoded protein undergoes further processing to generate the mature protein which mediates cell-cell interactions to trigger downstream signaling pathways. [provided by RefSeq, Jul 2015]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.