Thy1 (NM_009382) Mouse Untagged Clone

CAT#: MC209528

Thy1 (untagged) - Mouse thymus cell antigen 1, theta (Thy1), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Thy1
• Synonyms: CD90; T25; Thy-1; Thy-1.2; Thy1.1; Thy1.2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209528 representing NM_009382
  Red=Cloning site Blue=ORF
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAACCCAGCCATCAGCGTCGCTCTCCTGCTCTCAGTCTTGCAGGTGTCCCGAGGGCAGAAGGTGACCA
  GCCTGACAGCCTGCCTGGTGAACCAAAACCTTCGCCTGGACTGCCGCCATGAGAATAACACCAAGGATAA
  CTCCATCCAGCATGAGTTCAGCCTGACCCGAGAGAAGAGGAAGCACGTGCTCTCAGGCACCCTTGGGATA
  CCCGAGCACACGTACCGCTCCCGCGTCACCCTCTCCAACCAGCCCTATATCAAGGTCCTTACCCTAGCCA
  ACTTCACCACCAAGGATGAGGGCGACTACTTTTGTGAGCTTCAAGTCTCGGGCGCGAATCCCATGAGCTC
  CAATAAAAGTATCAGTGTGTATAGAGACAAGCTGGTCAAGTGTGGCGGCATAAGCCTGCTGGTTCAGAAC
  ACATCCTGGATGCTGCTGCTGCTGCTTTCCCTCTCCCTCCTCCAAGCCCTGGACTTCATTTCTCTGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_009382
• ORF Size: 489 bp
• Insert Size: 489
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: BC054436, AAH54436
• RefSeq Size: 1718
• RefSeq ORF: 489
• Locus ID: 21838
• Gene Summary: This gene encodes a glycoprotein that is anchored to the cell surface of thymocytes, neuronal and other cells through a glycosyl-phosphatidylinositol moiety. A soluble form of the encoded protein has also been detected in serum and cerebrospinal fluid. The encoded protein undergoes further processing to generate the mature protein which mediates cell-cell interactions to trigger downstream signaling pathways. [provided by RefSeq, Jul 2015]