Vegfa (NM_001110268) Mouse Untagged Clone

CAT#: MC209632

Vegfa (untagged) - Mouse vascular endothelial growth factor A (Vegfa), transcript variant 6, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Vegfa
• Synonyms: Vegf; Vpf
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209632 representing NM_001110268
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCAGGAGCCCCGGGGTGTCCCATAGGGGTATGGCTGGCTGGGTCACTAACCACTGTGATCTGCTCCC
  TCCCTCTACAGATCATGCGGATCAAACCTCACCAAAGCCAGCACATAGGAGAGATGAGCTTCCTACAGCA
  CAGCAGATGTGAATGCAGACCAAAGAAAGACAGAACAAAGCCAGAAAAATGTGACAAGCCAAGGCGGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001110268
• ORF Size: 210 bp
• Insert Size: 210
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001110268.1, NP_001103738.1
• RefSeq Size: 2653
• RefSeq ORF: 210
• Locus ID: 22339
• Gene Summary: This gene is a member of the PDGF/VEGF growth factor family. It encodes a heparin-binding protein, which exists as a disulfide-linked homodimer. This growth factor induces proliferation and migration of vascular endothelial cells, and is essential for both physiological and pathological angiogenesis. Disruption of this gene in mice resulted in abnormal embryonic blood vessel formation. This gene is upregulated in many known tumors and its expression is correlated with tumor stage and progression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. There is also evidence for alternative translation initiation from upstream non-AUG (CUG) codons resulting in additional isoforms. A recent study showed that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is antiangiogenic. Expression of some isoforms derived from the AUG start codon is regulated by a small upstream open reading frame, which is located within an internal ribosome entry site. [provided by RefSeq, Nov 2015]
  Transcript Variant: This variant (6) differs in the 5' UTR and 5' coding region and also lacks two consecutive in-frame, internal coding exons, compared to variant 1. The resulting isoform (6) has a distinct and shorter N-terminus and also lacks an internal segment, compared to isoform 1. This variant has transcript support, but the protein is predicted.