Dusp13 (NM_013849) Mouse Untagged Clone

CAT#: MC209789

Dusp13 (untagged) - Mouse dual specificity phosphatase 13 (Dusp13), transcript variant 2, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Dusp13
• Synonyms: DUSP13A; DUSP13B; Gm1203; LMW-DSP6; MDSP; TMDP; TS-DSP6
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209789 representing NM_013849
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCAGGCTGGGCAGAGACCACTGCAGTCTGCCCTTGGCATTTACCTGCCAAAGTCTCTTTCCCAGACAC
  CTCGATGTCCTTCTGTGAGAACGCTAGCCCCACTTGGTCTGTGCTCCCTAAGAGAAGAGGGGAGACAGAG
  AGGGAACAGCAGAGGAGACCAGGAGAAATGTGTTCTGAGGTTACAGCTAAAGAGAATGGACTCGCTACAG
  AAGCAGGAACTTCGGAGGCCAAAGATTCATGGGGCAGTCCAGGTGTCCCCCTACCAGCCACCCACACTGG
  CCTCTCTGCAGCGATTGCTGTGGGTCCGTCGGACTGCCACACTGACCCACATCAATGAGGTCTGGCCCAA
  CCTTTTCTTGGGAGATGCGTATGCTGCCAGAGACAAGGGTCGTCTAATCCAGCTGGGCATTACCCATGTT
  GTGAATGTGGCTGCGGGCAAGTTCCAGGTGGACACAGGTGCCAAGTTCTACCGTGGAACACCTCTGGAGT
  ACTATGGCATTGAGGCTGATGACAACCCCTTCTTTGACCTCAGCGTCCACTTTCTGCCTGTTGCTCGTTA
  CATCAGAGATGCCCTCAATATTCCCCGAAGCCGAGTGCTGGTCCACTGCGCTATGGGGGTGAGTCGCTCT
  GCCACAATTGTCTTGGCCTTCCTCATGATCTTCGAGAACATGACACTGGTAGATGCCATCCAGACGGTGC
  AGGCCCACCGAGATATCTGTCCCAACTCAGGCTTCCTCCGACAGCTCCAGGTTCTGGACAACAGGCTGAG
  GCGGGAAACAGGAAGACTCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_013849
• ORF Size: 792 bp
• Insert Size: 792
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_013849.3, NP_038877.2
• RefSeq Size: 1071
• RefSeq ORF: 792
• Locus ID: 27389
• Gene Summary: Members of the protein-tyrosine phosphatase superfamily cooperate with protein kinases to regulate cell proliferation and differentiation. This superfamily is separated into two families based on the substrate that is dephosphorylated. One family, the dual specificity phosphatases (DSPs) acts on both phosphotyrosine and phosphoserine/threonine residues. This gene encodes different but related DSP proteins through the use of non-overlapping open reading frames, alternate splicing, and presumed different transcription promoters. Expression of the distinct proteins from this gene has been found to be tissue specific and the proteins may be involved in postnatal development of specific tissues. A protein encoded by the upstream ORF was found in skeletal muscle, whereas the encoded protein from the downstream ORF was found only in testis. In humans, a similar pattern of expression was found. Multiple alternatively spliced transcript variants were described, but the full-length sequence of only some were determined. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) lacks several 5' exons and includes an alternate 5' exon, compared to variant 1. The resulting protein, isoform 2, (also called TMDP) is encoded from the downstream ORF of this gene and is found only in testis.