Oaz3 (NM_016901) Mouse Untagged Clone

CAT#: MC209944

Oaz3 (untagged) - Mouse ornithine decarboxylase antizyme 3 (Oaz3), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Oaz3
• Synonyms: Az-3; AZ3; Oaz-t
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209944 representing NM_016901
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  CTGCCTTGTAACAGGTCCCGCCCCTCTCTCTACTCCCTTTCTTATATCAAGAGGGGAAAAACACGGAACT
  ATCTCTATCCATTCTGGTCACCATTCGCCTATTACCTCTACTGTTACAAATACCGGATCACCCTCCGGGA
  GAAGATGCTGCCTTGTTGTTACAAAAGCATCACTTACAAGGAACAGGAGGACCTGACTCTCCGGCCCCAT
  TGCTGCCTCCCGTGCTCCTGCCTCCCGTGCTCCTGCCTCCAGTGCTCCCTGCCTTGTAACAGGTCCCGCC
  CCTCTCTCTACTCCCTTTCTTATATCAAGAGGGGAAAAACACGGAACTATCTCTATCCATTCTGGTCACC
  ATTCGCCTATTACCTCTACTGTTACAAATACCGGATCACCCTCCGGGAGAAGATGCTGCCTTGTTGTTAC
  AAAAGCATCACTTACAAGGAACAGGAGGACCTGACTCTCCGGCCCCATTGCTGCCTCCCGTGCTCCTGCC
  TCCCGTGCTCCTGCCTCCAGTGCTCC
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_016901
• ORF Size: 516 bp
• Insert Size: 516
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_016901.3, NP_058597.2
• RefSeq Size: 955
• RefSeq ORF: 733
• Locus ID: 53814
• Gene Summary: The protein encoded by this gene belongs to the ornithine decarboxylase antizyme family, which plays a role in cell growth and proliferation by regulating intracellular polyamine levels. Expression of antizymes requires +1 ribosomal frameshifting, which is enhanced by high levels of polyamines. Antizymes in turn bind to and inhibit ornithine decarboxylase (ODC), the key enzyme in polyamine biosynthesis; thus, completing the auto-regulatory circuit. This gene encodes antizyme 3, the third member of the antizyme family. Like antizymes 1 and 2, antizyme 3 inhibits ODC activity and polyamine uptake; however, it does not stimulate ODC degradation. Also, while antizymes 1 and 2 have broad tissue distribution, expression of antizyme 3 is restricted to haploid germ cells in testis, suggesting a distinct role for this antizyme in spermiogenesis. Antizyme 3 gene knockout studies showed that homozygous mutant male mice were infertile, and indicated the likely role of this antizyme in the formation of a rigid connection between the sperm head and tail during spermatogenesis. This transcript initiates translation from a non-AUG (CUG) codon that is highly conserved among the antizyme 3 orthologs. [provided by RefSeq, Dec 2014]