Fxyd7 (NM_022007) Mouse Untagged Clone
CAT#: MC210153
Fxyd7 (untagged) - Mouse FXYD domain-containing ion transport regulator 7 (Fxyd7), (10ug)
"NM_022007" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Fxyd7 |
Synonyms | 1110035I01Rik |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210153 representing NM_022007
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCACCCCAACCCAGAGCCCCACAAACGTTCCTGAAGAAACAGATCCTTTTTTCTATGACTATGCCA CTGTGCAGACTGTGGGGATGACCCTGGCCACTATCATGTTCGTGCTGGGGATCATCATCATCCTGAGCAA GAAGGTGAAGTGCAGGAAGGCGGATTCCAGGTCTGAGAGCCCAACATGCAAATCCTGTAAGTCGGAACTG CCCTCCTCAGCCCCTGGAGGTGGCGGTGTGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_022007 |
ORF Size | 243 bp |
Insert Size | 243 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_022007.1, NP_071290.1 |
RefSeq Size | 679 |
RefSeq ORF | 243 |
Locus ID | 57780 |
Gene Summary | This reference sequence was derived from multiple replicate ESTs and validated by similar human genomic sequence. This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The approved human gene nomenclature for the family is FXYD-domain containing ion transport regulator. Transmembrane topology has been established for two family members (FXYD1 and FXYD2), with the N-terminus extracellular and the C-terminus on the cytoplasmic side of the membrane. FXYD2, also known as the gamma subunit of the Na,K-ATPase, regulates the properties of that enzyme. FXYD1 (phospholemman), FXYD2 (gamma), FXYD3 (MAT-8), FXYD4 (CHIF), and FXYD5 (RIC) have been shown to induce channel activity in experimental expression systems. This gene product, FXYD7, is novel and has not been characterized as a protein. [RefSeq curation by Kathleen J. Sweadner, Ph.D., sweadner@helix.mgh.harvard.edu., Dec 2000] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR215577 | Fxyd7 (Myc-DDK-tagged) - Mouse FXYD domain-containing ion transport regulator 7 (Fxyd7) |
USD 68.00 |
|
MG215577 | Fxyd7 (GFP-tagged) - Mouse FXYD domain-containing ion transport regulator 7 (Fxyd7), (10ug) |
USD 300.00 |
|
MR215577L3 | Lenti ORF clone of Fxyd7 (Myc-DDK-tagged) - Mouse FXYD domain-containing ion transport regulator 7 (Fxyd7) |
USD 500.00 |
|
MR215577L4 | Lenti ORF clone of Fxyd7 (mGFP-tagged) - Mouse FXYD domain-containing ion transport regulator 7 (Fxyd7) |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review