Cldn12 (NM_001193659) Mouse Untagged Clone

CAT#: MC210232

Cldn12 (untagged) - Mouse claudin 12 (Cldn12), transcript variant 2, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Cldn12
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC210232 representing NM_001193659
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGGCTGCCGAGATGTCCACGCAGCCACCGTCCTGTCCTTCCTGTGTGGTATTGCCTCTGTCGCAGGCC
  TCTTTGCGGGGACTCTGCTTCCTAACTGGAGGAAACTGCGGCTGATCACATTCAACAGAAACGAGAAGAA
  CCTGACGATTTACACGGGCCTGTGGGTGAAGTGTGCCCGGTATGATGGAAGCAGTGACTGCCTGATGTAC
  GACCGTACGTGGTACCTGTCGGTTGACCAGCTGGACCTGCGTGTCCTCCAGTTTGCCCTGCCTCTCAGCA
  TCGTGATCGCAATGGGTGCCTTGCTACTCTGCCTGATTGGAATGTGTAACACGGCCTTCAATTCTTCCGT
  GCCTAACATCAAACTGGCCAAGTGTCTGGTCAATAGTGCAGGCTGCCACCTGGTGGCCGGACTCCTGTTT
  TTTCTGGCAGGTACCGTGAGCCTCTCTCCGTCCATCTGGGCCATCTTTTATAACAGCCATCTCAACAGGA
  AGTTTGAGCCGGTCTTTACCTTTGACTATGCAGTATTTGTCACTATTGCTAGCTCAGGGGGTCTGTTTAT
  GACTGCTCTCCTGCTGTTCGTTTGGTATTGTGCATGCAAGTCTTTGTCCTCTCCTTTCTGGCAACCGCTG
  TACTCTCACGCTCCCGGGATGCACACTTACTCACAGCCCTATTCATCACGGTCCCGCCTCTCTGCCATTG
  AAATCGACATTCCAGTAGTCTCACACAGCACTTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001193659
• ORF Size: 735 bp
• Insert Size: 735
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: NM_001193659.1, NP_001180588.1
• RefSeq Size: 3804
• RefSeq ORF: 735
• Locus ID: 64945
• Gene Summary: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene, along with several other family members, is expressed in the inner ear. The protein encoded by this gene and another family member, claudin 2, are critical for vitamin D-dependent Ca2+ absorption between enterocytes. Multiple alternatively spliced transcript variants encoding the same protein have been found. [provided by RefSeq, Oct 2011]
  Transcript Variant: This variant (2) differs in the 5' UTR, as compared to variant 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.