Commd6 (NM_001168592) Mouse Untagged Clone

CAT#: MC210302

Commd6 (untagged) - Mouse COMM domain containing 6 (Commd6), transcript variant 2, (10ug)


  "NM_001168592" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Commd6"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Commd6
Synonyms 1110059J08Rik; 1700063H17Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210302 representing NM_001168592
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGGAGTCTGGGTTCAGGGAGCCCGTGCTGGATGCCAAGTCGGAGCTTATAGATTTTCAGTGGAAAC
TGGGCATGGCTGTGAGCTCTGACAGCTGCAGATCTCTCAAGTATCCTTACGTGGCAGTGATGCTGAAGGT
GGCAGATCACTCTGGCCAAGTAAGCAGCAAGTCCATCGAGATGACAATTCCACAATTTCAGAATTTCTAC
AAACAGTTCAAAGAAATTGCCGCTGTAATTGAGACTGTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001168592
ORF Size 252 bp
Insert Size 252
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001168592.1, NP_001162064.1
RefSeq Size 892
RefSeq ORF 252
Locus ID 66200

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.