1500009L16Rik (NM_001145198) Mouse Untagged Clone

CAT#: MC211001

1500009L16Rik (untagged) - Mouse RIKEN cDNA 1500009L16 gene (1500009L16Rik), (10ug)


  "NM_001145198" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "1500009L16Rik"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol 1500009L16Rik
Synonyms 2700050C19Rik; OCC-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC211001 representing NM_001145198
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGTTGCGGGAACTCCACGGCCACCAGCGCGGCCGCGGGCCGAGGTCCAACAGGAGCAGTTAAAGACA
CAACAGAAGACTCGATAACGGAAGACGACAAGAGGAGAAACTATGGAGGAGTGTATGTTGGCCTGCCCTC
TGAAGCTGTCAACATGGCGTCTAGTCAAACAAAGACTGTACAGAAGAATTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001145198
ORF Size 192 bp
Insert Size 192
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001145198.1, NP_001138670.1
RefSeq Size 1211
RefSeq ORF 192
Locus ID 69784

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.