Defb41 (NM_183124) Mouse Untagged Clone

CAT#: MC211831

Defb41 (untagged) - Mouse defensin beta 41 (Defb41), (10ug)


  "NM_183124" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Defb41"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Defb41
Synonyms 9230102D03Rik; BD-17; Bd-41; Defb16; Defb17; Gm15386
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC211831 representing NM_183124
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGTTTCATCTATTTTTCTTTATTCTGCTCTTTGGGGCCACAATATTAACAGCCAGAAGTCATATTG
ACATCAAGAATGGAATAGAGAGATGTGAAAAAGTGCGAGGAATGTGTAAGACCGTCTGTGATATTGATGA
GTATGATTATGGATACTGTATCAGATGGAGGAACCAGTGCTGCATTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_183124
ORF Size 189 bp
Insert Size 189
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_183124.3, NP_898947.1
RefSeq Size 469
RefSeq ORF 189
Locus ID 77673

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.