Selenom (NM_053267) Mouse Untagged Clone

CAT#: MC212282

Selm (untagged) - Mouse selenoprotein M (Selm), (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Symbol: Selenom
• Synonyms: 1500040L08Rik; A230103K18; Selm; Sepm
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC212282 representing NM_053267
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAGCATCCTACTGTCGCCGCCGTCGCTGCTGCTGCTTCTTGCAGCCCTTGTGGCTCCAGCCACCTCCA
  CCACCAACTACCGACCGGATTGGAACCGTCTTCGAGGCCTGGCCAGGGGGCGGGTGGAGACCTGTGGAGG
  ATGACAGTTGAATCGCCTAAAGGAGGTGAAGGCCTTTGTCACCGAGGACATTCAACTGTACCACAACCTG
  GTGATGAAGCACCTCCCTGGGGCAGACCCCGAACTCGTGCTGTTAAGCCGAAATTACCAGGAACTAGAGC
  GAATCCCACTCAGCCAAATGACCCGGGACGAGATCAATGCGCTGGTACAGGAGCTCGGCTTCTACCGCAA
  GTCGGCGCCGGAAGCTCAGGTGCCCCCCGAGTACCTGTGGGCGCCCGCTAAGCCCCCCGAGGAAGCTTCA
  GAACACGACGACCTGTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_053267
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins.
• OTI Annotation: This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins.

Reference Data

• RefSeq: NM_053267.2, NP_444497.1
• RefSeq Size: 888
• RefSeq ORF: 438
• Locus ID: 114679
• Gene Summary: The protein encoded by this gene belongs to the selenoprotein M/SEP15 family. The exact function of this protein is not known. It is localized in the perinuclear region, is highly expressed in the brain, and may be involved in neurodegenerative disorders. Transgenic mice with targeted deletion of this gene exhibit increased weight gain, suggesting a role for this gene in the regulation of body weight and energy metabolism. This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec). Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. [provided by RefSeq, Dec 2016]