Ndufb6 (NM_001033305) Mouse Untagged Clone

CAT#: MC212875

Ndufb6 (untagged) - Mouse NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6 (Ndufb6), nuclear gene encoding mitochondrial protein, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ndufb6
• Synonyms: CI-B17; Gm137
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC212875 representing NM_001033305
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCAGGGTACACGCCGGATGAGAAGCTGCGGCTGCAGCAGCTGCGGGAGCTAAGGAGACGATGGCTGA
  AGGACCAGGAGCTGAGTCCCCGGGAGCCCGTGTTGCCCCCGCGCAGGATGTGGCCCCTGGAGCGATTCTG
  GGATAACTTTTTGCGGGACGGGGCCGTGTGGAAGAACATGGTCTTTAAGGCGTACCGCTCCAGTCTCTTC
  GCTGTTTCTCATGTGCTTATACCTATGTGGTTTGTTCACTATTATGTCAAATATCATATGGCTACTAAAC
  CATACACCATTGTTAGCTCGAAGCCCAGGATATTTCCAGGTGATACAATTCTGGAGACTGGAGAAGTAAT
  TCCACCAATGAGAGATTTTCCTGATCAACATCATTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001033305
• Insert Size: 387 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001033305.3, NP_001028477.1
• RefSeq Size: 682 bp
• RefSeq ORF: 387 bp
• Locus ID: 230075
• Cytogenetics: 4 A5
• Gene Summary: This gene encodes a subunit of complex I (NADH:ubiquinone oxidoreductase) of the mitochondrial respiratory chain. This complex functions in electron transport and generation of a proton gradient across the inner mitochondrial membrane to drive ATP synthesis. Data from human cell lines suggests that the encoded subunit may be required for electron transfer activity. [provided by RefSeq, Aug 2015]