Cxcl3 (NM_203320) Mouse Untagged Clone

CAT#: MC214575

Cxcl3 (untagged) - Mouse chemokine (C-X-C motif) ligand 3 (Cxcl3), (10ug)


  "NM_203320" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Cxcl3"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cxcl3
Synonyms Dcip1; Gm1960
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC214575 representing NM_203320
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCCCTCCCACCTGCCGGCTCCTCAGTGCTGCACTGGTCCTGCTGCTGCTGCTGGCCACCAACCACC
AGGCTACAGGGGCTGTTGTGGCCAGTGAGCTGCGCTGTCAGTGCCTGAACACCCTACCAAGGGTTGATTT
TGAGACCATCCAGAGCTTGACGGTGACGCCCCCAGGACCCCACTGCACCCAGACAGAAGTCATAGCCACT
CTCAAGGATGGTCAAGAAGTTTGCCTCAACCCCCAAGGCCCCAGGCTTCAGATAATCATCAAGAAGATAC
TGAAGAGCGGCAAGTCCAGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_203320
ORF Size 303 bp
Insert Size 303
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC117014, AAI17015
RefSeq Size 354
RefSeq ORF 303
Locus ID 330122
Gene Summary This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This secretory protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils. [provided by RefSeq, May 2013]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.