Hist1h2ao (NM_001177544) Mouse Untagged Clone

CAT#: MC215363

Hist1h2ao (untagged) - Mouse histone cluster 1, H2ao (Hist1h2ao), (10ug)


  "NM_001177544" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Hist1h2ao"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Hist1h2ao
Synonyms Hist1h2ap
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC215363 representing NM_001177544
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTGGACGCGGCAAGCAGGGTGGCAAGGCTCGCGCCAAGGCCAAGACCCGCTCCTCCCGGGCCGGCC
TGCAGTTCCCCGTGGGCCGCGTGCACCGGCTGCTCCGCAAGGGCAACTACTCGGAGCGCGTGGGCGCCGG
CGCCCCGGTCTACCTGGCGGCCGTGCTGGAGTACCTGACGGCCGAGATCCTGGAGCTGGCGGGCAACGCG
GCCCGCGACAACAAGAAGACGCGCATCATCCCGCGCCACCTGCAGCTGGCCATCCGCAACGACGAGGAGC
TCAACAAGCTGCTGGGCCGCGTGACCATCGCGCAGGGCGGCGTCCTGCCCAACATCCAGGCCGTGCTGCT
GCCCAAGAAGACCGAGAGCCACCACAAGGCCAAGGGAAAATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001177544
ORF Size 393 bp
Insert Size 393
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001177544.2, NP_001171015.1
RefSeq Size 552
RefSeq ORF 393
Locus ID 665433
Gene Summary Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. This structure consists of approximately 146 bp of DNA wrapped around a nucleosome, an octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2A family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. [provided by RefSeq, Aug 2015]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.