Anapc11 (NM_001038230) Mouse Untagged Clone
CAT#: MC225549
Anapc11 (untagged) - Mouse anaphase promoting complex subunit 11 (Anapc11), transcript variant 1
"NM_001038230" in other vectors (2)
Product Images
Other products for "Anapc11"
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Anapc11 |
Synonyms | 1110011I19Rik; R75218 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225549 representing NM_001038230
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAGGTGAAAATTAAATGTTGGAATGGTGTGGCCACTTGGCTCTGGGTAGCCAATGATGAGAACTGCG GCATCTGCAGGATGGCGTTTAATGGCTGCTGTCCAGACTGTAAGGTGCCTGGTGATGACTGCCCCCTCGT GTGGGGACAGTGCTCCCACTGCTTCCACATGCACTGCATCCTCAAGTGGCTGAATGCGCAGCAGGTGCAG CAGCACTGCCCCATGTGTCGCCAGGAGTGGAAGTTCAAAGAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001038230 |
Insert Size | 255 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This clone expresses the complete ORF with c-terminal tags of Myc-DDK. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001038230.2, NP_001033319.1 |
RefSeq Size | 3384 bp |
RefSeq ORF | 255 bp |
Locus ID | 66156 |
Cytogenetics | 11 E2 |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.