Hmga1 (NM_016660) Mouse Untagged Clone

CAT#: MC225664

Hmga1 (untagged) - Mouse high mobility group AT-hook 1 (Hmga1), transcript variant 1

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Hmga1
• Synonyms: AL023995; Hmga1a; Hmga1b; Hmgi; Hmgiy; Hmgy
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225664 representing NM_016660
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAGCGAGTCGGGCTCAAAGTCCAGCCAGCCCCTGGCCTCCAAGCAGGAAAAGGATGGGACTGAGAAGC
  GAGGCCGGGGCAGGCCACGCAAGCAGCCTCCGGTGAGTCCTGGGACGGCGCTGGTCGGGAGTCAGAAAGA
  GCCCAGTGAAGTGCCAACTCCGAAGAGACCTCGGGGCCGACCAAAGGGAAGCAAGAATAAGGGCGCCGCC
  AAGACCCGGAAAGTCACCACAGCTCCAGGGAGGAAACCAAGGGGCAGACCCAAGAAACTGGAGAAGGAGG
  AAGAGGAGGGCATCTCCCAGGAGTCCTCTGAGGAGGAGCAGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_016660
• ORF Size: 324 bp
• Insert Size: 324
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_016660.3, NP_057869.2
• RefSeq Size: 2004
• RefSeq ORF: 324
• Locus ID: 15361
• Gene Summary: This locus encodes a member of the nuclear, non-histone high mobility group protein family. This architectural transcription factor binds to A-T rich DNA sequences and participates in enhanceosome formation, chromatin remodeling and regulation of transcription. This protein functions in many cellular processes, including cell growth and differentiation. Alternatively spliced transcript variants have been described. [provided by RefSeq, Oct 2009]
  Transcript Variant: This variant (1) represents the longest transcript and encodes isoform a. Variants 1 through 5 encode the same isoform (a), also known as isoform I.