Cnih2 (NM_001302333) Mouse Untagged Clone

CAT#: MC225710

Cnih2 (untagged) - Mouse cornichon homolog 2 (Drosophila) (Cnih2), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Cnih2
• Synonyms: CNIH-2; Cnil
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225710 representing NM_001302333
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTGCTGTGCTGAGCGCGAGCGTTTGAAAAACATCGAACGCATCTGCTGCCTCCTGAGGAAGCTGGTGG
  TCCCGGAATATTCCATCCACGGCCTCTTCTGTCTGATGTTTCTGTGTGCAGCAGAGTGGGTGACCCTGGG
  CCTCAACATCCCCCTCCTCTTCTACCACCTCTGGAGGTACTTCCACCGTCCTGCGGATGGCTCTGAGGTC
  ATGTATGATGCGGTCTCTATCATGAATGCTGACATCCTCAACTACTGCCAGAAGGAGTCCTGGTGCAAAC
  TCGCCTTCTACCTGCTGTCCTTCTTCTATTACCTGTACAGTATGGTTTATACGTTGGTGAGCTTCTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001302333
• ORF Size: 348 bp
• Insert Size: 348
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001302333.1, NP_001289262.1
• RefSeq Size: 1387
• RefSeq ORF: 348
• Locus ID: 12794
• Gene Summary: This gene encodes a protein that is an auxiliary subunit of the ionotropic glutamate receptor of the AMPA subtype. This protein is similar to a Drosophila protein involved in anterior-posterior and dorsal-ventral patterning. Cnih2 conditional knockout mice exhibit reduced AMPA receptor synaptic transmission in the hippocampus. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
  Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1.