Arhgdib (NM_001301308) Mouse Untagged Clone

CAT#: MC225719

Arhgdib (untagged) - Mouse Rho, GDP dissociation inhibitor (GDI) beta (Arhgdib), transcript variant 5

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Arhgdib
• Synonyms: D4; Gdid4; Ly-GDI
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225719 representing NM_001301308
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGACCTTACTGGCGATCTCGAGGCCCTCAAAAAGGATACATTTGTGCTAAAGGAAGGCATTGAATACA
  GGGTGAAAATTAACTTCAAAGTGAATAAGGATATTGTGTCTGGCCTGAAGTATGTTCAACACACATACCG
  GACTGGCATGAGAGTGGATAAAGCCACATTCATGGTTGGCAGCTATGGGCCCCGACCAGAGGAGTACGAA
  TTCCTCACTCCAGTAGAGGAAGCTCCCAAGGGCATGCTGGCCCGAGGCACTTACCACAACAAGTCCTTCT
  TCACGGATGACGACAAACAGGACCACCTCACCTGGGAATGGAACCTGGCCATTAAGAAGGATTGGACAGA
  ATGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001301308
• ORF Size: 354 bp
• Insert Size: 354
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001301308.1, NP_001288237.1
• RefSeq Size: 1012
• RefSeq ORF: 354
• Locus ID: 11857
• Gene Summary: The protein encoded by this gene is a member of the Rho guanine nucleotide dissociation inhibitor (GDI) family. This gene is expressed at high levels in hematopoietic cells. This protein is cytosolic, and dissociation of Rho from this protein is required for membrane association and activation of Rho by Guanine Nucleotide Exchange Factors (GEFs). C-terminal truncations of this gene product have been reported to promote metastasis. Multiple transcript variants and protein isoforms exist. [provided by RefSeq, Aug 2014]
  Transcript Variant: This variant (5) lacks an in-frame exon in the coding region and uses a downstream start codon compared to variant 1. Variants 5 and 6 encode isoform 2 which has a shorter N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.