Ms4a2 (NM_001276329) Mouse Untagged Clone

CAT#: MC225770

Ms4a2 (untagged) - Mouse membrane-spanning 4-domains, subfamily A, member 2 (Ms4a2), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ms4a2
• Synonyms: Fce1b; Fcer1b; fcERI; FcRB; Fcrbeta; Ms4a1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225770 representing NM_001276329
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGACACAGAAAATAGGAGCAGAGCAGATCTTGCTCTCCCAAATCCACAAGAATCCTCCAGTGCACCTG
  ACATTGAACTCTTGGAAGCATCTCCTGCCAAAGCAGCCCCACCAAAGCAGACATGGCGGACATTTTTGAA
  GAAAGAGTTGGAGTTCCTGGGAGCAACACAAATTCTGTTTGTTTTGTCTGGATTTTTGTCAATTATCTCC
  GAAAGAAAAAACACATTGTATCTGAATGTAACCGAAGACGACGGCTGCTTTGTGGCTTCTTTCACCACAG
  TCCCAGATGATCGTCTTTATGAAGAATTAAATGTGTATTCACCAATTTACAGTGAGTTGGAAGACAAAGG
  GGAAACATCTTCTCCAGTTGATTCATAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001276329
• ORF Size: 378 bp
• Insert Size: 378
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001276329.1, NP_001263258.1
• RefSeq Size: 2429
• RefSeq ORF: 378
• Locus ID: 14126
• Gene Summary: This gene encodes a member of the membrane-spanning 4A family. The encoded protein is the beta subunit of the high affinity IgE receptor and is localized to the membrane. The encoded protein is required for full activation of mast cells, including the release of histamine. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
  Transcript Variant: This variant (3) uses two alternate in-frame splice sites and lacks an in-frame exon in the 3' coding region, compared to variant 1. The encoded isoform (c) is shorter than isoform a.