Hist1h2be (NM_001290530) Mouse Untagged Clone

CAT#: MC225773

Hist1h2be (untagged) - Mouse histone cluster 1, H2be (Hist1h2be), transcript variant 3


  "NM_001290530" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Hist1h2be"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Hist1h2be
Synonyms Gm11398
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225773 representing NM_001290530
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCTGAGCCAGCCAAGTCCGCTCCCGCCCCGAAGAAGGGCTCCAAGAAGGCTGTCACCAAGGCCCAGA
AGAAGGACGGCAAGAAGCGCAAGCGCAGCCGCAAGGAGAGCTACTCGGTGTACGTGTACAAGGTGCTGAA
GCAAGTGCACCCCGACACCGGCATCTCCTCCAAGGCCATGGGCATCATGAACTCGTTCGTGAACGACATC
TTCGAGCGCATCGCGGGCGAGGCGTCCCGCCTGGCGCATTACAACAAGCGCTCGACCATCACATCCCGGG
AGATCCAGACGGCCGTGCGCCTGCTGCTGCCCGGGGAGCTGGCCAAGCACGCGGTGTCGGAGGGCACCAA
GGCTGTCACCAAGTACACCAGCTCCAAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001290530
ORF Size 381 bp
Insert Size 381
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001290530.1, NP_001277459.1
RefSeq Size 445
RefSeq ORF 381
Locus ID 319179
Gene Summary Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene encodes a replication-dependent histone that is a member of the histone H2B family and generates multiple transcripts through alternative splicing, the use of the conserved stem-loop termination motif, and the polyA addition motif. [provided by RefSeq, Aug 2015]
Transcript Variant: This variant (3) is intronless and contains a palindromic termination sequence instead of a polyA signal and tail. Variants 1, 2 and 3 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.