Calca (NM_001289444) Mouse Untagged Clone

CAT#: MC225789

Calca (untagged) - Mouse calcitonin/calcitonin-related polypeptide, alpha (Calca), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Calca
• Synonyms: CA; Calc; Calc1; Cgrp; CGRP-1; CGRP1; Ct; Ctn
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225789 representing NM_001289444
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGGCTTCCTGAAGTTCTCCCCTTTCCTGGTTGTCAGCATCTTGCTCCTGTACCAGGCATGCAGCCTCC
  AGGCAGTGCCTTTGAGGTCAATCTTGGAAAGCAGCCCAGGCATGGCCACTCTCAGTGAAGAAGAAGTTCG
  CCTGCTGGCTGCACTGGTGCAGGACTATATGCAGATGAAAGCCAGGGAGCTGGAGCAGGAGGAAGAGCAG
  GAGGCTGAGGGCTCTAGTGTCACTGCTCAGAAGAGATCCTGCAACACTGCCACCTGTGTGACCCATCGGC
  TGGCAGGTCTGCTGAGCAGATCAGGAGGTGTGGTGAAGGACAACTTTGTTCCCACCAATGTGGGCTCTGA
  AGCCTTCGGCCGCCGCCGCAGGGACCTTCAGGCCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001289444
• ORF Size: 387 bp
• Insert Size: 387
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001289444.1, NP_001276373.1
• RefSeq Size: 1046
• RefSeq ORF: 387
• Locus ID: 12310
• Gene Summary: This gene encodes the peptide hormones calcitonin, calcitonin gene-related peptide (CGRP) and katacalcin. Alternative splicing of the mRNA results in multiple variants that encode either calcitonin or CGRP preproproteins. Post-translational processing of the calcitonin and CGRP propeptides results in either calcitonin and katacalcin, or CGRP, respectively. Calcitonin and katacalcin modulate calcium levels in the blood stream. CGRP can function as a vasodilator and play a role in the transmission of pain. The human homolog of CGRP was found to have antimicrobial activity. [provided by RefSeq, Mar 2015]
  Transcript Variant: This variant (3) has an altenate splice site in the 5' UTR, lacks the 3' terminal exon and has two alternate 3' exons, compared to variant 1. The resulting isoform (Cgrp) is shorter and has a distinct C-terminus, compared to isoform Calca. Both variants 2 and 3 encode the same isoform Cgrp.