Atp5g3 (NM_001301721) Mouse Untagged Clone

CAT#: MC225872

Atp5g3 (untagged) - Mouse ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C3 (subunit 9) (Atp5g3), transcript variant 1

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Atp5g3
• Synonyms: 6030447M23; Atp5mc3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225872 representing NM_001301721
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTTCGCCTGCGCCAAGCTCGCCCGCACCCCCGCTCTGATCCGAGCTGGATCCAGAGTTGCATATAGAC
  CAATTTCTGCATCAGTGTTATCTCGGCCAGAGACTAGGACTGGAGAGGGCTCTACAGTTTTTAATGGGGC
  CCAGAATGGTGTGTGTCAGCTGATCCGAAGGGAGTTTCAGACCAGTGTAATCAGCAGAGACATTGATACT
  GCTGCCAAATTCATTGGTGCAGGTGCTGCAACAGTAGGAGTTGCTGGTTCTGGTGCTGGTATTGGAACAG
  TCTTTGGCAGTCTTATCATTGGTTATGCCAGAAACCCTTCACTGAAGCAGCAGCTGTTCTCATATGCTAT
  CCTGGGATTTGCCTTGTCTGAAGCTATGGGTCTCTTTTGTTTGATGGTTGCGTTCTTGATCTTGTTTGCC
  ATGTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001301721
• ORF Size: 426 bp
• Insert Size: 426
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001301721.1, NP_001288650.1
• RefSeq Size: 739
• RefSeq ORF: 426
• Locus ID: 228033
• Gene Summary: The protein encoded by this gene is a subunit of mitochondrial membrane ATP synthase, the enzyme that catalyzes ATP synthesis during oxidative phosphorylation. This gene encodes subunit 9, which is present in multiple copies in the transmembrane part of the ATP synthase complex. Phenotype and gene expression profiles suggest correlations between this gene and alcoholism- and obesity-related phenotypes. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Sep 2014]
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a). Both variants 1 and 2 encode the same isoform (a).