Fdx1 (NM_001301728) Mouse Untagged Clone

CAT#: MC226034

Fdx1 (untagged) - Mouse ferredoxin 1 (Fdx1), transcript variant 2


  "NM_001301728" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Fdx1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Fdx1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226034 representing NM_001301728
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGCCGCTCCGGGCGCCCGACTCCTGCGCGCGGCCTGCGCCTCCGTCCCTTTCCGCGGCCTTGACC
GCTGTCGGCTGCTGGTCTGCGGGACCGGAGCGGGAACTGCCATCTCTCCGTGGACCCCGAGTCCCCGCCT
GCATGCAGAGGCCGGGCCCGGCCGGCCGCTGAGCGTGTCTGCGCGCGCGCGGAGCAGCTCAGAAGATAAG
ATAACAGTCCACTTCAAGAACCGAGATGGCGAGACGCTAACGACCAAGGGGAAAATTGGCGACTCTCTGC
TAGATGTTGTGATTGAGAACAACTTAGATATCGATGGGTTTGGTGCGTGTGAGGGAACGTTGGCTTGCTC
TACTTGTCATCTTATCTTTGAGGATCACATCTATGAGAAGTTAGATGCCATTACTGATGAAGAGAATGAC
ATGCTTGACCTGGCTTTTGGACTAACAGACAGGAACCTGGAAGACCCACCTATTTCCTTCAGCCCAGCAA
TTGGTCCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001301728
ORF Size 501 bp
Insert Size 501
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001301728.1, NP_001288657.1
RefSeq Size 2827
RefSeq ORF 501
Locus ID 14148
Gene Summary Ferrodoxins are iron-sulfur proteins that facilitate monooxygenase reactions catalyzed by P450 enzymes. The protein encoded by this gene is present in the mitochondrial matrix and transfers electrons from ferredoxin reductase to steroidogenic mitochondrial cytochrome P450 proteins. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
Transcript Variant: This variant (2) contains an alternate exon, which results in a frameshift, compared to variant 1. The resulting protein (isoform 2) has a shorter, distinct C-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.