C8g (NM_001271777) Mouse Untagged Clone

CAT#: MC226042

C8g (untagged) - Mouse complement component 8, gamma polypeptide (C8g), transcript variant 2


  "NM_001271777" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol C8g
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226042 representing NM_001271777
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCTTCCCCAATGCTACAGGGCACAGGGAGGCAGTTTGCAGGGACATGGCTCCTGGTGGCTGTGGGCT
CTTCGTGCCGCTTTCTTCAGGAGCAGGGACACCGAGCTGAGGCCACCACATTGCACGCAGCTCCCCAGGG
TGCAGCTATGGCTGTCAGCACCTTCCGAAAGCTAGATGGGATATGTTGGCAGGTACGCCAACTCTTTGAG
AACACAGGGGTCCCTGGCCGCTTCTTGTTCCAAGTCTCACGGGCCCGTGGACCAGTGCATATGGTGGTTG
CTGAGACTGACTATCAGAGCTTTGCCATCCTGTACCTGGAACAGGGAAGGAAGCTGTCTGTGAAACTATA
CGTCCGCTCACTGCCAGTGAATGACTCTGTCCTGGATGTGTTTGAGCGGCGAGTCAGGGAAGCCAACCTG
ACAGAAGATCAGATTCTTTTCTTTCCCAAGTATGGTTTCTGCGAGACTGCGGACCAATTACACATCCTGA
ACGAGGTGCCGCGATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001271777
ORF Size 507 bp
Insert Size 507
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001271777.1, NP_001258706.1
RefSeq Size 823
RefSeq ORF 507
Locus ID 69379
Gene Summary This gene encodes a secreted protein that is a core component of the complement 8 (C8) complex. C8 is part of the membrane attack complex which participates in the innate immune response against bacterial pathogens. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2012]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) is shorter and has a distinct N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.