Gsta3 (NM_001288617) Mouse Untagged Clone

CAT#: MC226050

Gsta3 (untagged) - Mouse glutathione S-transferase, alpha 3 (Gsta3), transcript variant 3


  "NM_001288617" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Gsta3"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Gsta3
Synonyms Gst2-3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226050 representing NM_001288617
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTCCAGCAAGTGCCCATGGTAGAGATCGACGGGATGAAACTGGTGCAGACCAAAGCCATTCTCAACT
ACATTGCCTCCAAATACAACCTCTATGGGAAGGACATGAAGGAGAGAGCCATCATTGACATGTACACAGA
AGGAGTGGCGGATCTGGAGATAATGATTCTCTATTACCCCCACATGCCCCCTGAGGAGAAAGAGGCAAGC
CTTGCCAAGATCAAGGAACAAACCAGGAACCGTTACTTCCCTGCCTTTGAAAAGGTGTTGAAGAGCCATG
GACAAGATTATCTCGTTGGCAACAGGCTGAGCAGGGCTGATATTGCCCTGGTTGAACTCCTCTACCATGT
GGAAGAGCTGGACCCGGGCGTTGTGGACAACTTCCCTCTCCTGAAAGCGCTGAGAAGCAGAGTCAGCAAC
CTCCCCACAGTGAAGAAGTTTCTTCAACCTGGCAGCCAGAGGAAGCCTTTTGATGACGCAAAATGTGTTG
AGTCAGCAAAGAAGATTTTCAGTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001288617
ORF Size 516 bp
Insert Size 516
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001288617.1, NP_001275546.1
RefSeq Size 1515
RefSeq ORF 516
Locus ID 14859
Gene Summary Conjugation of reduced glutathione to a wide number of exogenous and endogenous hydrophobic electrophiles. This GST has a high catalytic activity for aflatoxin B1-8,9 epoxide. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) contains a distinct 5' UTR and lacks an in-frame portion of the 5' coding region compared to variant 1. The resulting isoform (b) has a shorter N-terminus compared to isoform a. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.