Amelx (NM_001290371) Mouse Untagged Clone

CAT#: MC226061

Amelx (untagged) - Mouse amelogenin, X-linked (Amelx), transcript variant 3


  "NM_001290371" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Amelx"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Amelx
Synonyms ALGN; Amel; Amg; AMGL; AMGX; LRAP; Rgsc888
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226061 representing NM_001290371
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGGACCTGGATTTTGTTTGCCTGCCTCCTGGGAGCAGCTTTTGCTATGCCCCTACCACCTCATCCTG
GAAGCCCTGGTTATATCAACTTAAGCTATGAGGTGCTTACCCCTTTGAAGTGGTACCAGAGCATGATAAG
GCAGCCGCATCCCCCGAGTCACACCCTTCAGCCTCATCACCACCTTCCCGTGGTGCCAGCTCAACAGCCC
GTGGCCCCCCAGCAACCAATGATGCCAGTTCCTGGCCACCACTCCATGACTCCAACCCAACACCATCAGC
CAAACATCCCTCCATCCGCCCAGCAGCCCTTCCAGCAGCCCTTCCAGCCCCAGGCCATTCCACCCCAGTC
TCATCAGCCCATGCAGCCCCAGTCACCTCTGCATCCCATGCAGCCCCTGGCACCACAGCCACCTCTGCCT
CCACTGTTCTCCATGCAGCCCCTGTCCCCCATTCTTCCTGAGCTGCCTCTGGAAGCTTGGCCAGCGACAG
ACAAGACCAAGCGGGAAGAAGTGGATTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001290371
ORF Size 519 bp
Insert Size 519
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001290371.1, NP_001277300.1
RefSeq Size 752
RefSeq ORF 519
Locus ID 11704
Gene Summary Plays a role in the biomineralization of teeth. Seems to regulate the formation of crystallites during the secretory stage of tooth enamel development. Thought to play a major role in the structural organization and mineralization of developing enamel. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) contains multiple differences, compared to variant 1, including using an alternate 3' terminal exon. The encoded isoform (3) is shorter than isoform 1 and has a distinct C-terminus.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.