Cryaa (NM_001278570) Mouse Untagged Clone

CAT#: MC226065

Cryaa (untagged) - Mouse crystallin, alpha A (Cryaa), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Cryaa
• Synonyms: Acry-1; Crya-1; Crya1; DAcry-1; lop18
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226065 representing NM_001278570
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGACGTCACCATTCAGCATCCTTGGTTCAAGCGTGCCCTGGGGCCCTTCTACCCCAGCCGACTGTTCG
  ACCAGTTCTTCGGCGAGGGCCTTTTTGAGTACGACCTGCTGCCCTTCCTGTCTTCCACCATCAGCCCCTA
  CTACCGCCAGTCCCTCTTCCGCACTGTGCTGGACTCGGGCATCTCTGAGGTCCGATCTGACCGGGACAAG
  TTTGTCATCTTCTTGGACGTGAAGCACTTCTCTCCTGAGGACCTCACCGTGAAGGTACTGGAGGATTTTG
  TGGAGATTCACGGCAAACACAACGAGAGGCAGGATGACCATGGCTACATTTCCCGTGAATTTCACCGTCG
  CTACCGTCTGCCTTCCAATGTGGACCAGTCCGCCCTCTCCTGCTCCCTGTCTGCGGATGGCATGCTGACC
  TTCTCTGGCCCCAAGGTCCAGTCCGGTTTGGATGCTGGCCACAGCGAGAGGGCCATTCCTGTGTCACGGG
  AGGAGAAACCCAGCTCTGCACCCTCGTCCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001278570
• ORF Size: 522 bp
• Insert Size: 522
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001278570.1, NP_001265499.1
• RefSeq Size: 1127
• RefSeq ORF: 522
• Locus ID: 12954
• Gene Summary: This gene encodes subunit a, one of two subunits of alpha-crystallin, which is a high molecular weight, soluble aggregate and is a member of the small heat shock protein (sHSP) family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. It acts as a molecular chaperone and is the major protein in the eye lens, maintaining the transparency and refractive index of the lens. In mouse, deficiency in this gene is associated with smaller lenses and eyes and with increasing lens opacity with age. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
  Transcript Variant: This variant (3) lacks an alternate in-frame exon in the coding region compared to variant 1. It encodes isoform 3 which is shorter compared to isoform 1.